dsRNAmax (dsRNAmaximizer) uses a kmer-based approach for multi-target dsRNA design and off-target avoidance. The package maximizes the number of kmers (default = 21nt, a common length of DICER-processed siRNAs) that perfectly match each input target sequence while avoiding any contiguous match of a specified length to any off-target sequence (default = 21nt, but this off-target kmer length can be less than the target kmer length).
Beta build available: A pre-release with the latest bug fixes (
v1.1.15-beta.1) is on the Releases page for testing ahead of the next stable version. Bug reports and feedback are welcome via Issues.
-
Precompiled binaries for Windows, Linux and MacOS (Arm and Intel) can be downloaded from the Releases page.
-
For Linux and MacOS,
chmod +x {executable}may be required. -
To compile from source, install Go (1.18 or newer), clone this repository, and build with
go build- this will generate an executable for the operating system it was built on, with build dependencies downloaded automatically.
- The only required input is a FASTA file containing the target sequences the dsRNA should be optimised for. This will generate a 300nt dsRNA sense arm sequence that attempts to maximize the number of dsRNA-derived 21nt kmers that exactly match each input sequence.
Command:
dsRNAmax -h
Output:
dsRNAmax - dsRNA maximizer
Version: 1.1.15
Usage of dsRNAmax:
-biasHeader string
Header of target sequence to bias toward
-biasLvl int
Level of bias to apply
-constructLen int
dsRNA sense arm length (default 300)
-csv string
CSV file name (optional)
-iterations int
No. of iterations (default 100)
-kmerLen int
Kmer length (default 21)
-offTargetKmers string
Path to off-target kmer file (optional)
-offTargets string
Comma-separated list of off-target FASTA file/s
-otKmerLen int
Off-target Kmer length (must be <= kmer length) (default 21)
-targets string
Path to target FASTA file (required)
An example command and command line output is shown for the western corn rootworm and southern corn rootworm vATPase-A transcripts using the -targets flag. Statistics for the output dsRNA include the number of sense-arm derived kmers perfectly matching each target sequence (maximum = dsRNA length - kmer length +1), the Smith-Waterman-Gotoh similarity of the sense arm to each target sequence, mean kmer GC content, and the percentage of kmers (in both orientations) with a 5'U, 5'A and 5'C. The median of kmers matching to each target sequence along with the sense arm GC content are also shown.
Command:
dsRNAmax -targets wstrn_sthrn_corn_rootworm_vATPaseA.fa
Output:
dsRNAmax - dsRNA maximizer (Version: 1.1.15)
Target FASTA File: wstrn_sthrn_corn_rootworm_vATPaseA.fa
Loading target sequences...
---> 2 sequences loaded
Getting target sequence kmers...
3,358 target kmers loaded
Finding best construct...
Results:
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
| TARGET SEQUENCE HEADER | 21NT MATCHES | SWG SIMILARITY (%) | KMER MEAN GC (%) | 5'U (%) | 5'A (%) | 5'C (%) |
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
| WCR_vATPase_A | 217 | 95.0 | 43.2 | 27.6 | 30.4 | 26.3 |
| SCR_vATPase_A | 253 | 98.0 | 42.7 | 26.9 | 30.8 | 24.9 |
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
Median of kmer hits to each target sequence: 235
dsRNA sense-arm sequence - 43.3% GC content
ATCGGAGATGAAGAGAAGGAAGGGCAGTATGGTTACGTCCATGCTGTCTCAGGTCCAGTCGTTACTGCTGAGAAAATGTCTGGTTCTGCTATGTACGAACTGGTACGTGTCGGATACTATGAGCTGGTAGGAGAAATCATTAGATTGGAAGGTGACATGGCTACTATTCAGGTATATGAAGAAACTTCTGGTGTAACCGTTGGTGATCCAGTATTAAGAACTGGTAAACCACTTTCAGTAGAACTTGGACCTGGTATTATGGGTTCCATTTTTGATGGTATCCAACGTCCATTGAAAGAC
Additionally, off-target sequences can be added as a comma-separated list of FASTA files using the -offTargets flag or a KMER file generated by SeqToKmer using the -offTargetKmers flag. For large off-target datasets (e.g. metagenome FASTQ files), the SeqToKmer-generated KMER file approach is suggested.
In this example, the transcriptome of the beneficial seven-spotted ladybeetle is added using the -offTargets flag. No 21nt match from the generated dsRNA (in either orientation) will perfectly match any off-target sequence.
Command:
dsRNAmax -targets wstrn_sthrn_corn_rootworm_vATPaseA.fa -offTargets 7_spotted_ladybird.fa
Output:
dsRNAmax - dsRNA maximizer (Version: 1.1.15)
Target FASTA File: wstrn_sthrn_corn_rootworm_vATPaseA.fa
Off-target FASTA File: 7_spotted_ladybird.fa
Loading target sequences...
---> 2 sequences loaded
Getting target sequence kmers...
3,358 target kmers loaded
Removing off-target kmers from FASTA files...
Total off-target-matching kmers removed: 35
2024/04/17 16:44:06 Finding best construct...
Results:
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
| TARGET SEQUENCE HEADER | 21NT MATCHES | SWG SIMILARITY (%) | KMER MEAN GC (%) | 5'U (%) | 5'A (%) | 5'C (%) |
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
| WCR_vATPase_A | 226 | 97.0 | 34.6 | 35.5 | 30.3 | 19.3 |
| SCR_vATPase_A | 228 | 95.0 | 37.5 | 38.9 | 25.2 | 18.1 |
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
Median of kmer hits to each target sequence: 227
dsRNA sense-arm sequence - 37.3% GC content
AGGTAAAGCATCTCTAGCAGAAACGGACAAAATCACCTTGGAAATTGCCAGGCTTCTTAAAGAAGATTTCTTGCAACAAAACTCATACTCTTCTTATGACAGATTCTGTCCATTCTATAAAACTGTCGGTATGTTGAGAAACATGATCGGTTTGTACGATATGGCGAGACACGCCGTAGAATCAACCGCACAATCAGAAAATAAGATCACTTGGAACGTAATAAGAGATTCAATGAGTGGAATTTTATATCAACTTAGCAGTATGAAATTTAAGGATCCCGTAAAAGATGGTGAAGCTAA
In some cases, it's desirable to maximise the number of kmers matching a particular sequence, while still maintaining effectiveness against other input targets. This can be achieved by using -biasLvL and -biasHeader. For -biasHeader, the full header (excluding ">") should be entered - use quotes if there are spaces. For -biasLvl, input an integer for the degree of bias to apply. The integer used will add additional copies of the selected sequence to the design process, with its effect depended on the total number of input target sequences, so it's worth trialling different degrees of bias (starting at 1).
dsRNAmax -targets wstrn_sthrn_corn_rootworm_vATPaseA.fa -offTargets 7_spotted_ladybird.fa -biasHeader WCR_vATPase_A -biasLvl 1
Output:
dsRNAmax - dsRNA maximizer (Version: 1.1.15)
Target FASTA File: wstrn_sthrn_corn_rootworm_vATPaseA.fa
Off-target FASTA File: 7_spotted_ladybird.fa
Loading target sequences...
---> 2 sequences loaded
Applying bias modification to sequence 'WCR_vATPase_A' at level 1...
Getting target sequence kmers...
3,358 target kmers loaded
Removing off-target kmers from FASTA files...
Total off-target-matching kmers removed: 35
2024/04/18 10:40:39 Finding best construct...
Results:
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
| TARGET SEQUENCE HEADER | 21NT MATCHES | SWG SIMILARITY (%) | KMER MEAN GC (%) | 5'U (%) | 5'A (%) | 5'C (%) |
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
| WCR_vATPase_A | 280 | 100.0 | 43.9 | 30.4 | 26.1 | 28.6 |
| SCR_vATPase_A | 108 | 66.7 | 44.8 | 28.7 | 30.6 | 27.8 |
+------------------------+--------------+--------------------+------------------+---------+---------+---------+
Median of kmer hits to each target sequence: 194
dsRNA sense-arm sequence - 43.7% GC content
GAAAACTCGTCCATAATCGCGATAGTTGAGTGGGTGAGGTTCCAAGAGAAACATAACATCCATCCACAAATATGTCGAAAGTAAGGATCGGAGATGAAGAGAAGGAAGGGCAGTATGGTTATGTCCATGCTGTCTCAGGTCCAGTCGTTACTGCTGAGAAAATGTCTGGTTCTGCTATGTACGAACTGGTACGTGTCGGATACTATGAGCTGGTAGGAGAAATCATTAGATTGGAAGGTGACATGGCTACTATTCAGGTATACGAAGAAACATCAGGTGTAACTGTTGGTGATCCAGTAT
Why was no dsRNA generated?
- If the off-target sequences are too similar to the target sequences, no construct of the specified sense arm length can be generated. Try reducing the kmer length and/or the construct length.
If you use dsRNAmax, please cite:
Stephen J Fletcher, Jai Lawrence, Anne Sawyer, Narelle Manzie, Donald M Gardiner, Neena Mitter, Christopher A Brosnan. dsRNAmax: a multi-target chimeric dsRNA designer for safe and effective crop protection. NAR Genomics and Bioinformatics, Volume 7, Issue 2, June 2025, lqaf064, https://doi.org/10.1093/nargab/lqaf064
Released under the BSD 3-Clause License - see LICENSE.