Skip to content

pmenzel/RILogo

Repository files navigation

RILogo

Authors:
Peter Menzel pmenzel@gmail.com
Stefan Seemann seemann@rth.dk

Copyright 2012,2018 Peter Menzel, see file LICENCE

Description

RILogo is a command line program to create an RNA-RNA interaction logo from a pair of RNA sequences or alignments and outputs an SVG file. If alignments are given as input, then RILogo displays them as sequence logos. Intramolecular base pairs are displayed by arcs connecting the corresponding columns of the sequence logo. Intermolecular base pairs are denoted by connecting lines between both logos.

RILogo calculates the mutual information for base pairs and displays it through a colour gradient in the connecting arcs and lines. Additionally an 'M' character is placed on top of the other 4 letters in the sequences logos.

The source code of RILogo is available at http://github.com/pmenzel/RILogo

A web server is available at http://rth.dk/resources/rilogo

RILogo is published in:
P. Menzel, S.E. Seemann, J. Gorodkin
RILogo: Visualising RNA-RNA interactions
Bioinfomatics, 2012 Oct 1;28(19):2523-6

RILogo is distributed as open source software under the GNU Lesser General Public Licence 3, see the file LICENCE.

Installation

RILogo is written in C++ for Linux. It does not depend on additional libraries. To compile from source, simply type make and the program will be compiled into the binary file RILogo.

Usage

RILogo expects either one or two input files that contain the sequences as arguments, or can read a single input file from STDIN.

RILogo [options] file1.fa [file2.fa]  >output.svg

or

RILogo [options] <file.fa >output.svg

Input format

The input is either a single file or two files in FASTA alignment format. In the former case, the sequences of the two interacting RNAs need to be separated by the & character. All lines have to be of the same length. A secondary structure annotation has to be given in a special line with the name structure. Base pairs are denoted in the dot-bracket notation, see examples below.

Interactions between the two RNAs can be denoted in the structure line only by uppercase letters on the left side and corresponding lowercase letters on the right side of the separator &. Additionally uppercase and lowercase letters can be used together on one side exclusively to denote pseudoknots.

Example 1:

Simple internal structure, denoted by brackets, and interaction, denoted by AA and aa.

>seq1
AACGTAACGTAAACGAA&AACGTAAACGAAACGAA
>structure
..(((..BBB..)))..&..(((..bbb..)))..

Example 2:

Internal structure on the left side containing a pseudoknot, which is denoted by AA and aa. The interaction is denoted by BB and bb.

>seq1
AGCTAGCTAAGCTAAAGCAAAGCAA&AACGAGCCGTAA
>structure
.AAA.(((..BBB..aaa..)))..&.(((bbb)))..

Example 3:

This example shows the interaction between the bacterial small RNA OxyS and its binding site in the fhlA mRNA. See the files fhlA-OxyS.fa for the alignment, fhlA-OxyS.tree for the calculated phylogenetic tree, and fhlA-OxyS.treedist for the tree distances. The output of RILogo with default options using the command

RILogo -t fhlA-OxyS.treedist fhlA-OxyS.fa > fhlA-OxyS.svg

is in the file fhlA-OxyS.svg.

Command line parameters

-m NAME       Specify name of mutual information measure.
              Options are 'mi' and 'miwp'. Default is 'miwp'.
-t FILENAME   Switch to treeMI or treeMI^WP (depending on parameter -m) measure and
              specify the name of the file with the average tree distances.
-w            Use N_d instead of N in the weighting of observed and expected base pair frequencies.
-c FILENAME   Read configuration from file.
-d            Debug mode
-g            Debug mode for SVG output
-v            Verbose mode, prints calculated MI values to STDERR

The script nw_avg_dist.pl can be used to calculate the pairwise distances from a phylogenetic tree in Newick format (uses BioPerl), which can be used with option -t in RILogo.

Output

RILogo outputs a single vector graphics file in SVG format, which is written to STDOUT.

The SVG file can easily be converted to other file formats, for example with one of these commands, either using Inkscape or ImageMagick:

inkscape -f in.svg -A out.pdf
inkscape --export-png=out.png --export-width=800 in.svg
convert in.svg out.png

Configuration

RILogo can read a configuration file using option -c to customise the output. See default.cfg for the customisable parameters and their default values in RILogo.

About

Visualising RNA-RNA interactions

Topics

Resources

License

Stars

2 stars

Watchers

1 watching

Forks

Packages

 
 
 

Contributors

Languages