Skip to content

Repository files navigation

fun-gi: hamPCR + Douglas-fir + needle fungi

Kyle A. Gervers 2023-02-03

This work is unpublished. All results shown are preliminary.

Sections

hamPCR

Return

Host-associated microbe PCR (hamPCR) is a metabarcoding technique developed by Derek Lundberg et al. for quantifying microbial load in or on host tissues. Using a pair of host-specific primers to produce amplicons of a slightly different size (80-120 bp) relative to the target microbial amplicon, investigators can safely create a host reference internal to each sample that doesn’t swamp the more important microbial signal. After sequencing, dividing the count of microbial reads in each sample by the count of host reads creates and index of microbial load that’s comparable across samples. This microbial load index can also be examined for every microbial taxonomic unit, allowing investigators to examine which taxa have loads that are positively or negatively correlated with each other and which samples have more or less compositionally similar loads.

Notably, this is an improvement compared to methods which use the relative abundances of taxonomic units to describe communities. Because relative abundances are always constrained to sum to one, a real increase or decrease in the abundance of any taxonomic feature necessitates an artifactual decrease or increase in the relative abundance of all other features (and no, the order of “increase” and “decrease” was not swapped here). This means that relative abundance-based analyses are unable to distinguish between scenarios in which one taxonomic feature increases in actual abundance or in which all other taxonomic features decrease. While this downside to relative abundance analyses does not represent an inherent shortcoming if microbial ecologists adjust their interpretations appropriately, this adjustment is likely more of a compromise than is currently appreciated. For example, most ecologists are interested in knowing how a taxon responds to a meaningful environmental gradient or treatment. If the relative abundance of a taxon generally increases as the gradient increases in intensity, it’s unclear whether this result represents an outcome in which the taxon increasingly prefers a condition along a gradient or whether other taxa simply prefer it less. Further, unless microbial ecologists employ other means of estimating microbial load (qPCR, CFUs, cell-sorting, etc.), they generally cannot investigate fundamental phenomena centered around productivity, e.g., productivity-diversity relationships. hamPCR, similar to other “spike-in” approaches, represents a more achievable way to estimate microbial load while at the same time censusing the microbial community of interest.

Overview

Return

Following the protocol described by Lundberg et al., a primer pair was designed (Gi) that amplfies a portion of Gigantea coding sequence in coastal Douglas-fir (Pseudotsuga menziesii var. menziesii, PSME). This amplicon is ~100 bp larger than most amplicons produced with the fungal-specific primers 5.8S-Fun and ITS4-Fun (Fun), designed by D. Lee Taylor et al. 2016. Using this size difference, the primer concentration of Gi primers was optimized. To test whether or not fungal load calculations derived from this technique were reliable, PCRs were performed along a standard curve of Nothophaeocryptopus gaeumannii (NOGA) DNA serially diluted in PSME DNA. Additionally, 8 samples of pooled needle DNA extractions (DFSSMT samples) were included to predict where an average sample might fall along the standard curve.

Further, with the expectation of a future need to extend the number of barcode indices for multiplexing samples prior to sequencing, the 3-9 bp frameshift regions in each primer were incorporated into the multiplexing strategy. To account for the limited number of samples included on this run, frameshift combinations were randomly assigned to samples. Knowing that high indel rates could erode the fidelity of this multiplexing scheme, all pairwise combinations of forward and reverse frameshifts were used in demultiplexing. All samples were sequenced on an Illumina MiSeq using a 500-cycle (2x250 bp) Nano reagent kit with v2 chemistry.

Reproducibility

Return

All packages were installed and managed with conda.

conda 22.11.1
name: base
channels:
  - conda-forge
  - bioconda
  - defaults
dependencies:
  - fastqc=0.11.9
  - r-base=4.2.2
  - multiqc=1.13
  - gh=2.21.2
  - pheniqs=2.1.0
  - libgit2=1.5.0
  - git=2.39.0
  - itsx=1.1.3
  - cutadapt=4.2
  - vsearch=2.22.1
  - bioconductor-dada2=1.26.0
  - r-remotes=2.4.2
  - r-dplyr=1.0.10
  - atropos=1.1.31
  - r-rmarkdown=2.20
  - r-markdown=1.4
  - r-caret=6.0_93
  - r-vegan=2.6_4
prefix: /home/gerverska/projects/fun-gi/env

Installation

Return

Install the above bioinformatic environment from config.yml using the script 00-build.sh

# First clone the repository (using the gh CLI tool here) ####
gh repo clone gerverska/fun-gi

# Then run the build script ####
bash code/00-build.sh

A make implementation is on the horizon…

Results

Return

Descriptions are ongoing.

Demultiplex

Results

Pheniqs demultiplexing

Expand
{
    "incoming": {
        "count": 485439,
        "pf count": 485439,
        "pf fraction": 1.0
    },
    "sample": {
        "average classified confidence": 0.995882770326565,
        "average classified distance": 0.056203126625495,
        "average pf classified confidence": 0.999996737820934,
        "average pf classified distance": 0.044144460694003,
        "classified": [
            {
                "BC": "TAAGGCGA-CTCTCTAT",
                "ID": "TAAGGCGACTCTCTAT",
                "PU": "TAAGGCGACTCTCTAT",
                "average confidence": 0.992583341903079,
                "average distance": 0.08173554350317,
                "average pf confidence": 0.999992960508943,
                "average pf distance": 0.057718947206402,
                "barcode": [
                    "TAAGGCGA",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 13091,
                "estimated concentration": 0.026863814066185,
                "index": 1,
                "low conditional confidence count": 2220,
                "low confidence count": 97,
                "pf count": 12994,
                "pf fraction": 0.992590329233824,
                "pf pooled classified fraction": 0.03084936658373,
                "pf pooled fraction": 0.03084936658373,
                "pooled classified fraction": 0.03095179549259,
                "pooled fraction": 0.026967342961731
            },
            {
                "BC": "CGTACTAG-CTCTCTAT",
                "ID": "CGTACTAGCTCTCTAT",
                "PU": "CGTACTAGCTCTCTAT",
                "average confidence": 0.994717680500571,
                "average distance": 0.056995097775144,
                "average pf confidence": 0.999996983651887,
                "average pf distance": 0.041538044949905,
                "barcode": [
                    "CGTACTAG",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 18563,
                "estimated concentration": 0.038174567241197,
                "index": 2,
                "low conditional confidence count": 2020,
                "low confidence count": 98,
                "pf count": 18465,
                "pf fraction": 0.994720680924419,
                "pf pooled classified fraction": 0.043838198704677,
                "pf pooled fraction": 0.043838198704677,
                "pooled classified fraction": 0.043889556162932,
                "pooled fraction": 0.038239614040075
            },
            {
                "BC": "AGGCAGAA-CTCTCTAT",
                "ID": "AGGCAGAACTCTCTAT",
                "PU": "AGGCAGAACTCTCTAT",
                "average confidence": 0.993635236411458,
                "average distance": 0.064078923105292,
                "average pf confidence": 0.999997009753983,
                "average pf distance": 0.042590702421824,
                "barcode": [
                    "AGGCAGAA",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 10846,
                "estimated concentration": 0.022280385115536,
                "index": 3,
                "low conditional confidence count": 2928,
                "low confidence count": 69,
                "pf count": 10777,
                "pf fraction": 0.99363820763415,
                "pf pooled classified fraction": 0.025585933790431,
                "pf pooled fraction": 0.025585933790431,
                "pooled classified fraction": 0.025643814369615,
                "pooled fraction": 0.022342663032842
            },
            {
                "BC": "TCCTGAGC-CTCTCTAT",
                "ID": "TCCTGAGCCTCTCTAT",
                "PU": "TCCTGAGCCTCTCTAT",
                "average confidence": 0.99031219056888,
                "average distance": 0.080303749406739,
                "average pf confidence": 0.99999414623245,
                "average pf distance": 0.047829004121537,
                "barcode": [
                    "TCCTGAGC",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 10535,
                "estimated concentration": 0.021569199026667,
                "index": 4,
                "low conditional confidence count": 4770,
                "low confidence count": 102,
                "pf count": 10433,
                "pf fraction": 0.99031798766018,
                "pf pooled classified fraction": 0.024769235152228,
                "pf pooled fraction": 0.024769235152228,
                "pooled classified fraction": 0.024908499389995,
                "pooled fraction": 0.021702005813294
            },
            {
                "BC": "GGACTCCT-CTCTCTAT",
                "ID": "GGACTCCTCTCTCTAT",
                "PU": "GGACTCCTCTCTCTAT",
                "average confidence": 0.993005307011426,
                "average distance": 0.081369776939993,
                "average pf confidence": 0.999995536571184,
                "average pf distance": 0.056394842996124,
                "barcode": [
                    "GGACTCCT",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 12732,
                "estimated concentration": 0.026138156167368,
                "index": 5,
                "low conditional confidence count": 5565,
                "low confidence count": 89,
                "pf count": 12643,
                "pf fraction": 0.99300973923971,
                "pf pooled classified fraction": 0.03001604907789,
                "pf pooled fraction": 0.03001604907789,
                "pooled classified fraction": 0.030102991384283,
                "pooled fraction": 0.026227806171321
            },
            {
                "BC": "TAGGCATG-CTCTCTAT",
                "ID": "TAGGCATGCTCTCTAT",
                "PU": "TAGGCATGCTCTCTAT",
                "average confidence": 0.995426509524237,
                "average distance": 0.063869560702045,
                "average pf confidence": 0.999996020887729,
                "average pf distance": 0.049295774647887,
                "barcode": [
                    "TAGGCATG",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 19258,
                "estimated concentration": 0.039632085243095,
                "index": 6,
                "low conditional confidence count": 4664,
                "low confidence count": 88,
                "pf count": 19170,
                "pf fraction": 0.995430470453837,
                "pf pooled classified fraction": 0.045511956088203,
                "pf pooled fraction": 0.045511956088203,
                "pooled classified fraction": 0.045532784172049,
                "pooled fraction": 0.039671307826524
            },
            {
                "BC": "CTCTCTAC-CTCTCTAT",
                "ID": "CTCTCTACCTCTCTAT",
                "PU": "CTCTCTACCTCTCTAT",
                "average confidence": 0.994112675344305,
                "average distance": 0.063799621928166,
                "average pf confidence": 0.999993756035123,
                "average pf distance": 0.045742657933657,
                "barcode": [
                    "CTCTCTAC",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 19044,
                "estimated concentration": 0.039140043704866,
                "index": 7,
                "low conditional confidence count": 3482,
                "low confidence count": 112,
                "pf count": 18932,
                "pf fraction": 0.994118882587691,
                "pf pooled classified fraction": 0.044946914588516,
                "pf pooled fraction": 0.044946914588516,
                "pooled classified fraction": 0.045026811806652,
                "pooled fraction": 0.039230469739761
            },
            {
                "BC": "CGAGGCTG-CTCTCTAT",
                "ID": "CGAGGCTGCTCTCTAT",
                "PU": "CGAGGCTGCTCTCTAT",
                "average confidence": 0.994809624235609,
                "average distance": 0.064481904986443,
                "average pf confidence": 0.999996450099617,
                "average pf distance": 0.047991468183434,
                "barcode": [
                    "CGAGGCTG",
                    "CTCTCTAT"
                ],
                "concentration": 0.034615384615384,
                "count": 8483,
                "estimated concentration": 0.01744680059293,
                "index": 8,
                "low conditional confidence count": 894,
                "low confidence count": 44,
                "pf count": 8439,
                "pf fraction": 0.994813155723211,
                "pf pooled classified fraction": 0.020035231999392,
                "pf pooled fraction": 0.020035231999392,
                "pooled classified fraction": 0.020056839138617,
                "pooled fraction": 0.017474904158915
            },
            {
                "BC": "TCTCTCTC-GTCACAGT",
                "ID": "TCTCTCTCGTCACAGT",
                "PU": "TCTCTCTCGTCACAGT",
                "average confidence": 0.994784662927791,
                "average distance": 0.067400066672727,
                "average pf confidence": 0.999997243644427,
                "average pf distance": 0.054683929931454,
                "barcode": [
                    "TCTCTCTC",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 32997,
                "estimated concentration": 0.067862451648649,
                "index": 9,
                "low conditional confidence count": 373,
                "low confidence count": 172,
                "pf count": 32825,
                "pf fraction": 0.994787404915598,
                "pf pooled classified fraction": 0.077930618601735,
                "pf pooled fraction": 0.077930618601735,
                "pooled classified fraction": 0.078016682901917,
                "pooled fraction": 0.067973524994901
            },
            {
                "BC": "CGAACGAA-GTCACAGT",
                "ID": "CGAACGAAGTCACAGT",
                "PU": "CGAACGAAGTCACAGT",
                "average confidence": 0.997423140369594,
                "average distance": 0.047173740203687,
                "average pf confidence": 0.999997624087383,
                "average pf distance": 0.040121465173657,
                "barcode": [
                    "CGAACGAA",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 26413,
                "estimated concentration": 0.054465690439715,
                "index": 10,
                "low conditional confidence count": 334,
                "low confidence count": 68,
                "pf count": 26345,
                "pf fraction": 0.997425510165448,
                "pf pooled classified fraction": 0.062546295416991,
                "pf pooled fraction": 0.062546295416991,
                "pooled classified fraction": 0.062449757416987,
                "pooled fraction": 0.054410543858239
            },
            {
                "BC": "CACAGTCA-GTCACAGT",
                "ID": "CACAGTCAGTCACAGT",
                "PU": "CACAGTCAGTCACAGT",
                "average confidence": 0.997320309988289,
                "average distance": 0.035196866269189,
                "average pf confidence": 0.999998955769751,
                "average pf distance": 0.028677872119216,
                "barcode": [
                    "CACAGTCA",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 34719,
                "estimated concentration": 0.071585841608107,
                "index": 11,
                "low conditional confidence count": 448,
                "low confidence count": 93,
                "pf count": 34626,
                "pf fraction": 0.997321351421411,
                "pf pooled classified fraction": 0.082206415832557,
                "pf pooled fraction": 0.082206415832557,
                "pooled classified fraction": 0.08208810539357,
                "pooled fraction": 0.071520829599599
            },
            {
                "BC": "AGGTCTAC-GTCACAGT",
                "ID": "AGGTCTACGTCACAGT",
                "PU": "AGGTCTACGTCACAGT",
                "average confidence": 0.997348026018819,
                "average distance": 0.039590063495599,
                "average pf confidence": 0.999999243797853,
                "average pf distance": 0.032815082875396,
                "barcode": [
                    "AGGTCTAC",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 44885,
                "estimated concentration": 0.092549292018383,
                "index": 12,
                "low conditional confidence count": 446,
                "low confidence count": 119,
                "pf count": 44766,
                "pf fraction": 0.997348780216107,
                "pf pooled classified fraction": 0.106280032667945,
                "pf pooled fraction": 0.106280032667945,
                "pooled classified fraction": 0.106124157106783,
                "pooled fraction": 0.092462698711887
            },
            {
                "BC": "GTACTGGT-CTTGGTAG",
                "ID": "GTACTGGTCTTGGTAG",
                "PU": "GTACTGGTCTTGGTAG",
                "average confidence": 0.996343373298746,
                "average distance": 0.07096210212372,
                "average pf confidence": 0.999994301225264,
                "average pf distance": 0.060693641618497,
                "barcode": [
                    "GTACTGGT",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 19447,
                "estimated concentration": 0.040057969935848,
                "index": 13,
                "low conditional confidence count": 6271,
                "low confidence count": 71,
                "pf count": 19376,
                "pf fraction": 0.996349051267547,
                "pf pooled classified fraction": 0.046001025621545,
                "pf pooled fraction": 0.046001025621545,
                "pooled classified fraction": 0.045979647616255,
                "pooled fraction": 0.040060646136795
            },
            {
                "BC": "TGTCGACA-CTTGGTAG",
                "ID": "TGTCGACACTTGGTAG",
                "PU": "TGTCGACACTTGGTAG",
                "average confidence": 0.998431059431249,
                "average distance": 0.050660410149461,
                "average pf confidence": 0.999995181195371,
                "average pf distance": 0.045648389904264,
                "barcode": [
                    "TGTCGACA",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 23016,
                "estimated concentration": 0.047508884657607,
                "index": 14,
                "low conditional confidence count": 3493,
                "low confidence count": 36,
                "pf count": 22980,
                "pf fraction": 0.998435870698644,
                "pf pooled classified fraction": 0.054557368331085,
                "pf pooled fraction": 0.054557368331085,
                "pooled classified fraction": 0.054418037205519,
                "pooled fraction": 0.047412754228646
            },
            {
                "BC": "AGAGACAC-CTTGGTAG",
                "ID": "AGAGACACCTTGGTAG",
                "PU": "AGAGACACCTTGGTAG",
                "average confidence": 0.997038619573882,
                "average distance": 0.044014084507042,
                "average pf confidence": 0.999996355272575,
                "average pf distance": 0.035598248340161,
                "barcode": [
                    "AGAGACAC",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 14200,
                "estimated concentration": 0.029270269320383,
                "index": 15,
                "low conditional confidence count": 2648,
                "low confidence count": 42,
                "pf count": 14158,
                "pf fraction": 0.997042253521126,
                "pf pooled classified fraction": 0.033612846859508,
                "pf pooled fraction": 0.033612846859508,
                "pooled classified fraction": 0.033573867236634,
                "pooled fraction": 0.02925187304687
            },
            {
                "BC": "AGCAAGGT-CTTGGTAG",
                "ID": "AGCAAGGTCTTGGTAG",
                "PU": "AGCAAGGTCTTGGTAG",
                "average confidence": 0.998391073692307,
                "average distance": 0.043764785400473,
                "average pf confidence": 0.999996339868168,
                "average pf distance": 0.038503850385038,
                "barcode": [
                    "AGCAAGGT",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 11836,
                "estimated concentration": 0.024430482593513,
                "index": 16,
                "low conditional confidence count": 4430,
                "low confidence count": 19,
                "pf count": 11817,
                "pf fraction": 0.998394727948631,
                "pf pooled classified fraction": 0.028055022696624,
                "pf pooled fraction": 0.028055022696624,
                "pooled classified fraction": 0.027984527648788,
                "pooled fraction": 0.024382054181884
            },
            {
                "BC": "CTTGCTTG-CTTGGTAG",
                "ID": "CTTGCTTGCTTGGTAG",
                "PU": "CTTGCTTGCTTGGTAG",
                "average confidence": 0.993911478416935,
                "average distance": 0.055688319212108,
                "average pf confidence": 0.999994433913257,
                "average pf distance": 0.040947176684881,
                "barcode": [
                    "CTTGCTTG",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 13809,
                "estimated concentration": 0.028375084505033,
                "index": 17,
                "low conditional confidence count": 2955,
                "low confidence count": 84,
                "pf count": 13725,
                "pf fraction": 0.993917010645231,
                "pf pooled classified fraction": 0.03258485118991,
                "pf pooled fraction": 0.03258485118991,
                "pooled classified fraction": 0.032649403709203,
                "pooled fraction": 0.028446416542552
            },
            {
                "BC": "GGTAGCAA-CTTGGTAG",
                "ID": "GGTAGCAACTTGGTAG",
                "PU": "GGTAGCAACTTGGTAG",
                "average confidence": 0.99742023490636,
                "average distance": 0.071603727317312,
                "average pf confidence": 0.999995013631994,
                "average pf distance": 0.063368162261831,
                "barcode": [
                    "GGTAGCAA",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 16312,
                "estimated concentration": 0.033636621121813,
                "index": 18,
                "low conditional confidence count": 1890,
                "low confidence count": 42,
                "pf count": 16270,
                "pf fraction": 0.997425208435507,
                "pf pooled classified fraction": 0.03862699663824,
                "pf pooled fraction": 0.03862699663824,
                "pooled classified fraction": 0.038567388898871,
                "pooled fraction": 0.033602574164828
            },
            {
                "BC": "AGAGACAC-GTCACAGT",
                "ID": "AGAGACACGTCACAGT",
                "PU": "AGAGACACGTCACAGT",
                "average confidence": 0.996735207450991,
                "average distance": 0.042661627440874,
                "average pf confidence": 0.999999248978321,
                "average pf distance": 0.033953809031368,
                "barcode": [
                    "AGAGACAC",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 17463,
                "estimated concentration": 0.035985189136219,
                "index": 19,
                "low conditional confidence count": 1095,
                "low confidence count": 57,
                "pf count": 17406,
                "pf fraction": 0.996735956021302,
                "pf pooled classified fraction": 0.041324001443467,
                "pf pooled fraction": 0.041324001443467,
                "pooled classified fraction": 0.041288763630517,
                "pooled fraction": 0.035973623874472
            },
            {
                "BC": "AGCAAGGT-GTCACAGT",
                "ID": "AGCAAGGTGTCACAGT",
                "PU": "AGCAAGGTGTCACAGT",
                "average confidence": 0.99742482593274,
                "average distance": 0.04788764385221,
                "average pf confidence": 0.999999020868349,
                "average pf distance": 0.039775315014422,
                "barcode": [
                    "AGCAAGGT",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 26416,
                "estimated concentration": 0.054471892643979,
                "index": 20,
                "low conditional confidence count": 315,
                "low confidence count": 68,
                "pf count": 26348,
                "pf fraction": 0.997425802543912,
                "pf pooled classified fraction": 0.062553417788835,
                "pf pooled fraction": 0.062553417788835,
                "pooled classified fraction": 0.06245685048753,
                "pooled fraction": 0.054416723831418
            },
            {
                "BC": "CTTGCTTG-GTCACAGT",
                "ID": "CTTGCTTGGTCACAGT",
                "PU": "CTTGCTTGGTCACAGT",
                "average confidence": 0.991661403479869,
                "average distance": 0.061457887986318,
                "average pf confidence": 0.999998285293991,
                "average pf distance": 0.040094848027592,
                "barcode": [
                    "CTTGCTTG",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 9356,
                "estimated concentration": 0.01918135038526,
                "index": 21,
                "low conditional confidence count": 153,
                "low confidence count": 78,
                "pf count": 9278,
                "pf fraction": 0.991663103890551,
                "pf pooled classified fraction": 0.022027121991984,
                "pf pooled fraction": 0.022027121991984,
                "pooled classified fraction": 0.022120922666616,
                "pooled fraction": 0.01927327635398
            },
            {
                "BC": "GGTAGCAA-GTCACAGT",
                "ID": "GGTAGCAAGTCACAGT",
                "PU": "GGTAGCAAGTCACAGT",
                "average confidence": 0.996990573003608,
                "average distance": 0.06447135035089,
                "average pf confidence": 0.999998202362143,
                "average pf distance": 0.0546875,
                "barcode": [
                    "GGTAGCAA",
                    "GTCACAGT"
                ],
                "concentration": 0.034615384615384,
                "count": 12967,
                "estimated concentration": 0.026727365572391,
                "index": 22,
                "low conditional confidence count": 361,
                "low confidence count": 39,
                "pf count": 12928,
                "pf fraction": 0.996992365234826,
                "pf pooled classified fraction": 0.030692674403145,
                "pf pooled fraction": 0.030692674403145,
                "pooled classified fraction": 0.030658615243481,
                "pooled fraction": 0.026711904070336
            },
            {
                "BC": "TCTCTCTC-CTTGGTAG",
                "ID": "TCTCTCTCCTTGGTAG",
                "PU": "TCTCTCTCCTTGGTAG",
                "average confidence": 0.986441006735191,
                "average distance": 0.12136409227683,
                "average pf confidence": 0.999981376426014,
                "average pf distance": 0.07727503812913,
                "barcode": [
                    "TCTCTCTC",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 1994,
                "estimated concentration": 0.004066578595366,
                "index": 23,
                "low conditional confidence count": 4527,
                "low confidence count": 27,
                "pf count": 1967,
                "pf fraction": 0.986459378134403,
                "pf pooled classified fraction": 0.004669901806233,
                "pf pooled fraction": 0.004669901806233,
                "pooled classified fraction": 0.004714527554214,
                "pooled fraction": 0.004107622172919
            },
            {
                "BC": "CGAACGAA-CTTGGTAG",
                "ID": "CGAACGAACTTGGTAG",
                "PU": "CGAACGAACTTGGTAG",
                "average confidence": 0.996500453543878,
                "average distance": 0.071522023549934,
                "average pf confidence": 0.999989295394359,
                "average pf distance": 0.060831509846827,
                "barcode": [
                    "CGAACGAA",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 2293,
                "estimated concentration": 0.004724012247286,
                "index": 24,
                "low conditional confidence count": 1534,
                "low confidence count": 8,
                "pf count": 2285,
                "pf fraction": 0.996511120802442,
                "pf pooled classified fraction": 0.005424873221781,
                "pf pooled fraction": 0.005424873221781,
                "pooled classified fraction": 0.005421470251662,
                "pooled fraction": 0.004723559499751
            },
            {
                "BC": "CACAGTCA-CTTGGTAG",
                "ID": "CACAGTCACTTGGTAG",
                "PU": "CACAGTCACTTGGTAG",
                "average confidence": 0.995460675240547,
                "average distance": 0.050855991943605,
                "average pf confidence": 0.999992362684737,
                "average pf distance": 0.036418816388467,
                "barcode": [
                    "CACAGTCA",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 1986,
                "estimated concentration": 0.004087252609577,
                "index": 25,
                "low conditional confidence count": 2149,
                "low confidence count": 9,
                "pf count": 1977,
                "pf fraction": 0.995468277945619,
                "pf pooled classified fraction": 0.004693643045716,
                "pf pooled fraction": 0.004693643045716,
                "pooled classified fraction": 0.004695612699433,
                "pooled fraction": 0.004091142244442
            },
            {
                "BC": "AGGTCTAC-CTTGGTAG",
                "ID": "AGGTCTACCTTGGTAG",
                "PU": "AGGTCTACCTTGGTAG",
                "average confidence": 0.968634539829152,
                "average distance": 0.177700348432055,
                "average pf confidence": 0.999993211981894,
                "average pf distance": 0.064748201438848,
                "barcode": [
                    "AGGTCTAC",
                    "CTTGGTAG"
                ],
                "concentration": 0.034615384615384,
                "count": 287,
                "estimated concentration": 0.000574737595074,
                "index": 26,
                "low conditional confidence count": 2526,
                "low confidence count": 9,
                "pf count": 278,
                "pf fraction": 0.968641114982578,
                "pf pooled classified fraction": 0.000660006457617,
                "pf pooled fraction": 0.000660006457617,
                "pooled classified fraction": 0.000678570415275,
                "pooled fraction": 0.000591217434116
            }
        ],
        "classified count": 422948,
        "classified fraction": 0.871269098692111,
        "classified pf fraction": 0.995886019085088,
        "count": 485439,
        "estimated noise": 0.129193982207943,
        "index": 0,
        "low conditional confidence count": 62491,
        "low confidence count": 1740,
        "pf classified count": 421208,
        "pf classified fraction": 1.0,
        "pf count": 421208,
        "pf fraction": 0.86768471424834,
        "unclassified": {
            "ID": "undetermined",
            "PU": "undetermined",
            "count": 62491,
            "index": 0,
            "pf count": 0,
            "pf fraction": 0.0,
            "pf pooled fraction": 0.0,
            "pooled classified fraction": 0.147751023766515,
            "pooled fraction": 0.128730901307888
        }
    }
}

Out of 485,439 read pairs (reads) obtained from the sequencing run, 128,919 reads (27%) were demultiplexed with indices used in this experiment. Overall, 62,491 reads (13%) could not be demultiplexed to any expected index pair. This large proportion of undemultiplexed reads was investigated further.

Trim

Results

Cutadapt primer trimming

Expand
This is cutadapt 4.2 with Python 3.10.8
Command line parameters: -e 0.1 --no-indels -j 32 --discard-untrimmed -g ^file:scratch/rev-adapters.fa -o scratch/trim2/P01-02-D-n09_gi_fwd-{name}-R2.fq.gz -p scratch/trim2/P01-02-D-n09_gi_fwd-{name}-R1.fq.gz scratch/trim1/P01-02-D-n09_gi_fwd-R2.fq.gz scratch/trim1/P01-02-D-n09_gi_fwd-R1.fq.gz
Processing paired-end reads on 32 cores ...
Finished in 0.288 s (9282.220 µs/read; 0.01 M reads/minute).

=== Summary ===

Total read pairs processed:                 31
  Read 1 with adapter:                       1 (3.2%)
Pairs written (passing filters):             1 (3.2%)

Total basepairs processed:        14,601 bp
  Read 1:         7,781 bp
  Read 2:         6,820 bp
Total written (filtered):            444 bp (3.0%)
  Read 1:           224 bp
  Read 2:           220 bp

=== First read: Adapter n01_fun_rev ===

Sequence: NAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 22; Trimmed: 0 times

=== First read: Adapter n02_fun_rev ===

Sequence: NNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 23; Trimmed: 0 times

=== First read: Adapter n03_fun_rev ===

Sequence: NNNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 24; Trimmed: 0 times

=== First read: Adapter n04_fun_rev ===

Sequence: NNNNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 25; Trimmed: 0 times

=== First read: Adapter n05_fun_rev ===

Sequence: NNNNNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 26; Trimmed: 0 times

=== First read: Adapter n06_fun_rev ===

Sequence: NNNNNNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 27; Trimmed: 0 times

=== First read: Adapter n07_fun_rev ===

Sequence: NNNNNNNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 28; Trimmed: 0 times

=== First read: Adapter n08_fun_rev ===

Sequence: NNNNNNNNAACTTTYRRCAAYGGATCWCT; Type: anchored 5'; Length: 29; Trimmed: 0 times

=== First read: Adapter n04_gi_rev ===

Sequence: NNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 22; Trimmed: 0 times

=== First read: Adapter n05_gi_rev ===

Sequence: NNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 23; Trimmed: 0 times

=== First read: Adapter n06_gi_rev ===

Sequence: NNNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 24; Trimmed: 0 times

=== First read: Adapter n07_gi_rev ===

Sequence: NNNNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 25; Trimmed: 0 times

=== First read: Adapter n08_gi_rev ===

Sequence: NNNNNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 26; Trimmed: 0 times

=== First read: Adapter n09_gi_rev ===

Sequence: NNNNNNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 27; Trimmed: 1 times

No. of allowed errors: 1

Overview of removed sequences
length  count   expect  max.err error counts
27  1   0.0 1   1


=== First read: Adapter n10_gi_rev ===

Sequence: NNNNNNNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 28; Trimmed: 0 times

=== First read: Adapter n11_gi_rev ===

Sequence: NNNNNNNNNNNATGCCTGAGCACAAACAG; Type: anchored 5'; Length: 29; Trimmed: 0 times

Atropos overlap trimming

Expand
2023-01-27 12:24:26,567 INFO: This is Atropos 1.1.31 with Python 3.10.8
2023-01-27 12:24:26,574 INFO: Trimming 2 adapters with at most 10.0% errors in paired-end mode ...
2023-01-27 12:24:26,610 INFO: Starting 31 worker processes
2023-01-27 12:24:26,683 INFO: Starting 1 worker processes
=======
Atropos
=======

Atropos version: 1.1.31
Python version: 3.10.8
Command line parameters: trim -e 0.1 --aligner insert --insert-match-error-rate 0.2 -T 32 -a AGWGATCCRTTGYYRAAAGTT -A AYTTAAGCATATCAATAAGCGGAGG -o 02-trim/P01-01-C-n04_fun_fwd-n01_fun_rev-rc-R1.fq.gz -p 02-trim/P01-01-C-n04_fun_fwd-n01_fun_rev-rc-R2.fq.gz -pe1 scratch/trim2/P01-01-C-n04_fun_fwd-n01_fun_rev-R1.fq.gz -pe2 scratch/trim2/P01-01-C-n04_fun_fwd-n01_fun_rev-R2.fq.gz

Sample ID: P01-01-C-n04_fun_fwd-n01_fun_rev-R
Input format: FASTQ, Paired, w/ Qualities
Input files:
  /nfs1/BPP/Spatafora_Lab/gerversk/projects/fun-gi/scratch/trim2/P01-01-C-n04_fun_fwd-n01_fun_rev-R1.fq.gz
  /nfs1/BPP/Spatafora_Lab/gerversk/projects/fun-gi/scratch/trim2/P01-01-C-n04_fun_fwd-n01_fun_rev-R2.fq.gz

Start time: 2023-01-27T12:24:26.570431
Wallclock time: 0.11 s (109267 us/read; 0.00 M reads/minute)
CPU time (main process): 0.11 s

--------
Trimming
--------

Pairs                               records fraction
----------------------------------- ------- --------
Total read pairs processed:            1
  Read 1 with adapter:                 0    0
  Read 2 with adapter:                 0    0
Pairs written (passing filters):       1 100.0%

Base pairs                            bp fraction
----------------------------------- ---- --------
Total bp processed:                  451
  Read 1:                            222
  Read 2:                            229
Total bp written (filtered):         451 100.0%
  Read 1:                            222 100.0%
  Read 2:                            229 100.0%

---------------------
First read: Adapter 1
---------------------

Sequence              Type       Length Trimmed (x)
--------------------- ---------- ------ -----------
AGWGATCCRTTGYYRAAAGTT regular 3'     21           0

----------------------
Second read: Adapter 2
----------------------

Sequence                  Type       Length Trimmed (x)
------------------------- ---------- ------ -----------
AYTTAAGCATATCAATAAGCGGAGG regular 3'     25           0

2023-01-27 12:24:38,204 INFO: This is Atropos 1.1.31 with Python 3.10.8
2023-01-27 12:24:38,211 INFO: Trimming 2 adapters with at most 10.0% errors in paired-end mode ...
2023-01-27 12:24:38,249 INFO: Starting 31 worker processes
2023-01-27 12:24:38,325 INFO: Starting 1 worker processes
=======
Atropos
=======

Atropos version: 1.1.31
Python version: 3.10.8
Command line parameters: trim -e 0.1 --aligner insert --insert-match-error-rate 0.2 -T 32 -a CTGTTTGTGCTCAGGCAT -A GAGGTAGATATTCCAGAACACG -o 02-trim/P01-01-C-n07_gi_fwd-n06_gi_rev-rc-R1.fq.gz -p 02-trim/P01-01-C-n07_gi_fwd-n06_gi_rev-rc-R2.fq.gz -pe1 scratch/trim2/P01-01-C-n07_gi_fwd-n06_gi_rev-R1.fq.gz -pe2 scratch/trim2/P01-01-C-n07_gi_fwd-n06_gi_rev-R2.fq.gz

Sample ID: P01-01-C-n07_gi_fwd-n06_gi_rev-R
Input format: FASTQ, Paired, w/ Qualities
Input files:
  /nfs1/BPP/Spatafora_Lab/gerversk/projects/fun-gi/scratch/trim2/P01-01-C-n07_gi_fwd-n06_gi_rev-R1.fq.gz
  /nfs1/BPP/Spatafora_Lab/gerversk/projects/fun-gi/scratch/trim2/P01-01-C-n07_gi_fwd-n06_gi_rev-R2.fq.gz

Start time: 2023-01-27T12:24:38.207855
Wallclock time: 0.11 s (57120 us/read; 0.00 M reads/minute)
CPU time (main process): 0.11 s

--------
Trimming
--------

Pairs                               records fraction
----------------------------------- ------- --------
Total read pairs processed:            2
  Read 1 with adapter:                 0    0
  Read 2 with adapter:                 0    0
Pairs written (passing filters):       2 100.0%

Base pairs                            bp fraction
----------------------------------- ---- --------
Total bp processed:                  898
  Read 1:                            444
  Read 2:                            454
Total bp written (filtered):         898 100.0%
  Read 1:                            444 100.0%
  Read 2:                            454 100.0%

---------------------
First read: Adapter 1
---------------------

Sequence           Type       Length Trimmed (x)
------------------ ---------- ------ -----------
CTGTTTGTGCTCAGGCAT regular 3'     18           0

----------------------
Second read: Adapter 2
----------------------

Sequence               Type       Length Trimmed (x)
---------------------- ---------- ------ -----------
GAGGTAGATATTCCAGAACACG regular 3'     22           0

Although only certain combinations of frameshifted primers were used, all pairwise combinations of potential frameshifts were used to trim Fun and Gi reads. Additionally, shorter and longer frameshifts were also used to identify instances were insertions and deletions in frameshift sequences occurred. This approach initially inflates the number of trimmed reads. Accordingly, a total of 89,707 reads (70% of demultiplexed reads) where trimmed with Fun or Gi primers. 1,910 reads among the 62,491 undemuliplexed reads (3%) could be trimmed with Fun or Gi primers, suggesting that most potential reads were properly demultiplexed in the previous step with Pheniqs.

Denoise

Results

DADA2 error-modeling

Expand

Sequence error correction (denoising) with DADA2 was performed separately for Fun and Gi reads. Prior to quality filtering and trimming, 72,673 reads (81%) had been trimmed with Fun primers, while 17,034 reads (19%) were trimmed with Gi primers. Filtering and trimming retained most reads (Fun = 71,139, Gi = 16,780), but this loss continued through denoising and read merging. Overall, Fun reads retained a greater percentage of sequences (97%) than Gi reads (91%).

Frameshift trimming profiles

To examine the feasibility of frameshift indexing for larger libraries, indel occurrence rate (i.e., the rate at which single or multiple insertions and deletions occurred) was investigated using the shortest and longest expected frameshift pairs associated with Fun and Gi primers. Instances in which trimmed and denoised reads had shorter or longer frameshifts than the shortest and longest expected frameshift pairs were identified as instances of deletion and insertion, respectively. Overall, 99% of Fun reads had expected frameshift pairs used in this experiment, but this rate was lower (92%) for Gi reads. Insertion occurrence rates were generally fairly low (Fun = 0.1%, Gi = 0.6%) relative to deletion occurrence rate (Fun = 1%, Gi = 6%), with Gi reads generally experiencing higher rates of indels.

Retaining all denoised samples (even those which did not match any expected frameshift pair), a total of 53 Fun amplicon sequencing variants (ASVs) and 59 Gi ASVs were obtained. Many of these ASVs belonged to non-target frameshifts, so these erroneous samples were not retained in downstream analyses.

Compile

Results

LULU post-clustering of Fun ASVs

Expand
####processing: fun_OTU.1 #####
---hits: fun_OTU.3 
---hits: fun_OTU.4 
---hits: fun_OTU.5
---potential parent: 
No parent found!

####processing: fun_OTU.3 #####
---hits: fun_OTU.1 
---hits: fun_OTU.4 
---hits: fun_OTU.5
---potential parent: fun_OTU.1
------checking: fun_OTU.1
------relative cooccurence: 1 which is sufficient!
------min avg abundance: 32.8 which is OK!
SETTING fun_OTU.3 to be an ERROR of fun_OTU.1

####processing: fun_OTU.2 #####
---hits: 
---potential parent: 
No parent found!

####processing: fun_OTU.4 #####
---hits: fun_OTU.1 
---hits: fun_OTU.3
---potential parent: fun_OTU.1 
---potential parent: fun_OTU.3
------checking: fun_OTU.1
------relative cooccurence: 1 which is sufficient!
------min avg abundance: 103.945945945946 which is OK!
SETTING fun_OTU.4 to be an ERROR of fun_OTU.1

------checking: fun_OTU.3
####processing: fun_OTU.5 #####
---hits: fun_OTU.1 
---hits: fun_OTU.3
---potential parent: fun_OTU.1 
---potential parent: fun_OTU.3
------checking: fun_OTU.1
------relative cooccurence: 0
------checking: fun_OTU.3
------relative cooccurence: 0
No parent found!

LULU post-clustering of Gi ASVs

Expand
####processing: gi_OTU.1 #####
---hits: gi_OTU.2 
---hits: gi_OTU.3
---potential parent: 
No parent found!

####processing: gi_OTU.2 #####
---hits: gi_OTU.1 
---hits: gi_OTU.3
---potential parent: gi_OTU.1
------checking: gi_OTU.1
------relative cooccurence: 1 which is sufficient!
------min avg abundance: 2.20670391061453 which is OK!
SETTING gi_OTU.2 to be an ERROR of gi_OTU.1

####processing: gi_OTU.3 #####
---hits: gi_OTU.1 
---hits: gi_OTU.2
---potential parent: gi_OTU.1 
---potential parent: gi_OTU.2
------checking: gi_OTU.1
------relative cooccurence: 1 which is sufficient!
------min avg abundance: 10.8850574712644 which is OK!
SETTING gi_OTU.3 to be an ERROR of gi_OTU.1

------checking: gi_OTU.2

To group merged ASVs into ideally less artifactual operational taxonomic units (OTUs) Fun and Gi ASVs were post-clustered with the co-occurrence-informed LULU algorithm. In order for a less abundant “child” ASV to cluster with a more abundant “parent” ASV, the child needed to occur with the parent in 95% of samples. Fun ASV sequences also needed to have 97% similarity to investigate child-parent status, while 85% similarity was permitted for Gi ASVs. These percentages were not thoroughly investigated, and higher similarity thresholds will likely be tolerated. After clustering, only 3 Fun OTUs were retained. The most abundant OTU (OTU.1) was assigned to NOGA (Nothophaeocryptopus gaeumannii, bootstrap support = 95%). This was followed by OTU.2, which was assigned to Zasmidium pseudotsugae with 97% bootstrap support. A third OTU was also assigned to NOGA with lower support (81%), but this OTU occurred as a single read in a single negative control sample. Only one other negative control sample was contaminated with a single OTU.1 read. As expected, a single Gi OTU was obtained after clustering.

Rarefy

Results

Sequencing bias prior to rarefaction

For each sample, a load index for each Fun OTU was calculated as the quotient of the number of reads associated with that Fun OTU divided by the number of reads associated with the single Gi OTU in that sample. To investigate bias in sequencing depth, the relationship between the load of NOGA (assigned to OTU.1) and the proportion of NOGA DNA diluted into PSME DNA was examined across samples associated with this standard curve. This relationship suggested that dilutions containing greater amounts of NOGA DNA were generally sequenced to greater depths compared to samples with less NOGA DNA. Given this, a rarefaction-based approach (involving repeated subsampling and averaging) was pursued in downstream analysis of the standard curve.

All samples were randomly subsampled 1,000 times to a depth of 740 reads when read depth allowed. This depth was only partially explored, but it was chosen because it was the depth necessary to recover Gi reads from all subsamples (necessary to create a rarefied calculation of load). Out of 36, 27 had sufficient sequencing depth. Most samples that failed were among with the 8 samples of pooled needle DNA extractions (DFSSMT samples). Interpretation of these samples proceeded using non-rarefied estimates of load. These failures were likely due to known issues with amplification relative to samples involved in the NOGA standard curve.

Analyze

Results

Base model

Regress NOGA load onto known NOGA dilution, without accounting for Fun + Gi frameshifts

base <- lm(log10(mean_noga_load) ~ log10(dilution), standard)

base-residuals

Full model

Regress NOGA load onto known NOGA dilution, treating Fun + Gi frameshifts as random effects

library(nlme)

full <- lme(log10(mean_noga_load) ~ log10(dilution),
            random = list(fun_n = ~ 1, gi_n = ~ 1),
            data = standard,
            method = 'ML',
            na.action = na.omit)
Full model residuals Fun frameshift random intercepts Gi frameshift random intercepts (nested within Fun)
full-residuals fun-full-rand gi-full-rand

To test whether hamPCR-derived load calculations were incapable of represented known biological reality, fixed and mixed effect linear regression was performed with samples derived from the standard curve. Both full (mixed effect) and base (fixed effect) models included the proportion of NOGA DNA as an a fixed-effect, independent variable. The full model included Fun and Gi frameshift pairs as 4-level random effects. With more samples, each level of NOGA dilution would have samples associated with all combinations of Fun and Gi pairs (16) in order to investigate them as a fixed effect. Unfortunately, the effect of frameshift pair could only be accounted for with a mixed effect model. Full and base models were compared with a likelihood ratio test. The simplest model was retained if the null hypothesis could not be rejected. Leave-one-out cross-validation (LOOCV) was performed to investigate the sensitivity of this model to missing samples. Model residuals were also retained for further investigation.

NOGA load regressed on NOGA dilution

Base model residuals associated with each frameshift pair

Comparing DFSSMT samples with relative abundance and fungal load data

Raw metrics

Hierarchical clustering

Relative abundance Log-transformed load
ra-clust load-clust