Ali Osman Berk Şapcı, Eleonora Rachtman, Siavash Mirarab, CONSULT-II: Accurate taxonomic identification and profiling using locality-sensitive hashing, Bioinformatics, 2024;, btae150, https://doi.org/10.1093/bioinformatics/btae150
- CONSULT-II
CONSULT-II is a tool for taxonomic identification and successor of CONSULT. CONSULT-II extends CONSULT by enabling taxonomic classification and abundance profiling, in addition to contamination removal. The paper1 where we have described the design of the algorithm and software architecture is available online.
Relying on locality-sensitive hashing, CONSULT-II extracts k-mers from a query set and tests whether they fall within a user-specified hamming distance of k-mers in the reference dataset. Using this invaluable information, it can derive taxonomic predictions for given query reads, or abundance estimation for samples. Furthermore, for a given query read, CONSULT-II can report k-mer matches, Hamming distances to corresponding references, and probabilistic taxonomic least common ancestor (LCA) of matched reference k-mers. It supports the inclusion of approximately billions k-mers in its reference library, accommodating datasets with tens of thousands of microbial species. CONSULT-II is efficiently parallelized and can handle very large datasets.
Despite being memory-hungry, our careful benchmarking shows that CONSULT-II outperforms popular k-mer-based tools such as Kraken-2 and CLARK in accuracy. We provide reference libraries, so you can download them and jump into taxonomic identification of your queries.
The exact memory footprint depends on the number of k-mers in a reference set, and the parameters used. CONSULT-II requires enough free memory to hold the entire reference library in RAM, and this is needed during library construction and searching query kmers. During, classification and abundance profiling, CONSULT-II reads matching information from the disk. Using the default values (or heuristic), some examples of approximately required memory (conservative upper bounds) with respect to the number of k-mers in a reference set can be listed below;
-
$2^{28}$ k-mers$\rightarrow$ $<5$ GB, -
$2^{30}$ k-mers$\rightarrow$ $<20$ GB, -
$2^{32}$ k-mers$\rightarrow$ $<80$ GB.
We note that during library construction the user will need slightly more RAM than the given values to accommodate intermediary processes (about an additional 10%). Once the reference library is built, these values should be sufficient. For instance, the main reference library, with more than 10k species and about 8 billion k-mers leads to memory usage varying between 140GB and 150GB. In addition to the reference library and metadata, CONSULT-II also needs to store k-mer match information per read to disk, which then be read during classification and profiling. This shouldn't exceed input data file sizes (usually less than 10% of input size).
CONSULT-II is a command-line tool implemented in C++11 with some x86 assembly code. Many steps of CONSULT-II are embarrassingly parallelized, such as reference library reading, query search, classification, and profiling, using OpenMP. Compilation requires g++ that supports C++11. For our tests, we have compiled versions 4.8.5 and 7.2.0, both of which work. External tools such as Jellyfish might be useful for reference library construction.
-
Download using one of two approaches:
- You can obtain the zip file and extract the contents to a folder of your choice. Then, proceed to compilation.
- Alternatively, you can clone the GitHub repository and continue with compilation.
-
To compile, go to the directory where core programs (consult_*.cpp) are located and run the below commands.
- You can use
maketo compile CONSULT.
make all # for all components of CONSULT # OR make minimize # for the minimization script make map # for consult_map to construct a library make search # for consult_search to make queries make classify # for consult_classify to perform read-level classification from match info make profile # for consult_profile to perform abundance profiling from match info
- Alternatively, you can run
g++directly.
g++ minimize.cpp -std=c++11 -o minimize # for the minimization script g++ consult_map.cpp -std=c++11 -O3 -o consult_map # for consult_map to construct a library g++ consult_search.cpp -std=c++11 -fopenmp -O3 -o consult_search # for consult_search to make queries g++ consult_classify.cpp -std=c++11 -fopenmp -O3 -o consult_classify # for consult_classify to perform read-level classification from match info g++ consult_profile.cpp -std=c++11 -fopenmp -O3 -o consult_profile # for consult_profile to perform abundance profiling from match info
- You can use
To test your installation, and gain a better insight into input/output files and CONSULT-II's workflow, see the directory example.
To test all functionality, run make all in example.
As a result, the following files should be generated:
-
G000307305-k32C_minimized.fa: minimized k-mers, in FASTA format, -
G000307305_nbr_mapping: a directory to store reference library files, such as k-mer encodings, taxonomic LCAs, metadata, -
classified-seq_query000: list of reads with at least one (defaultcvalue) k-mer match, -
unclassified-seq_query000: list of reads without any k-mer match, -
kmer-distances_query000: number of k-mer matches across different Hamming distances for each read, -
match-info_query000: list of matched k-mers with taxonomic LCA, this file is used byconsult_classifyandconsult_profile, -
classification_query000: taxon predictions for each read, -
profile_query000-*: an abundance profile for each rank.
We made some libraries available online, and many more will be in the future. See Public libraries for a list, just click on them to download. You may want to use wget or a similar tool. If you would like to use a pre-built library, skip this subsection and jump to Taxonomic identification subsection.
We suggest the following workflow to obtain the k-mer lists from FASTA files. To construct the CONSULT-II library from multiple assembly references, follow the steps below.
- To combine assembly references into single file use
catas follows.
cat /path/to/folder/*.fna > combined.fna- Extraction of canonical 35 bp k-mers from FASTA genomic reference can be done with Jellyfish.
- To compute k-mer profile run
jellyfish count.
jellyfish count -m 35 -s 100M -t 24 -C combined.fna -o counts.jf- To output a list of k-mers associated with their counts use
jellyfish dump.
jellyfish dump counts.jf > 35bp_kmer_lst.fa- Minimization could be performed using custom C++11 script we provide.
The script accepts a FASTA file (output of Jellyfish as an input containing 35 bp canonical k-mers extracted from reference and outputs their 32 bp minimizers in FASTA format.
Run
minimizeas below.
./minimize -i 35bp_kmer_lst.fa -o 32bp_minzer_lst.fa- Extraction of unique 32 bp k-mers from the minimizers could be useful to further reduce k-mer count and remove duplicate sequences.
- To compute k-mer profile run
jellyfish countagain.
jellyfish count -m 32 -s 100M -t 24 -C 32bp_minzer_lst.fa -o counts.jf- To export the list of k-mers and their counts use
jellyfish dump.
jellyfish dump counts.jf > 32bp_kmer_lst.faWe note that, in our experiments, we used the minimization technique to decrease the total k-mer count in the original datasets and to reduce memory requirements. Alternatively, if a dataset is small enough, and minimization is not needed, the user can use the last command directly to obtain a list of all 32 bp k-mers and utilize it as input into CONSULT-II software.
To construct a standard reference library, use the following command to run consult_map as follows:
./consult_map -i /path/to/fasta_file -o $LIBRARY_NAME
# for example:
./consult_map -p 3 -t 2 -i k32C_af_mininimization.fa -o G000307305_nbr_mapwhere -t is tag size in bits, and determines the number of partitions ( -p is the Hamming distance threshold for a match, and /path/to/fasta_file is supposed to be the path of the input FASTA file, formatted as shown in the corresponding section.
Replace $LIBRARY_NAME above with your preferred library name, which also will be the path of the reference library directory relative to the current working directory.
You can also give a path to another valid directory other than the current working directory: $/path/to/$LIBRARY_NAME.
Note that, CONSULT-II will not create parent directories of the given library path for you.
If the given directory path already contains a reference library with the same name, the software will throw an exception.
This feature is to prevent existing reference libraries from being overwritten.
In the reference library directory, several non-human-readable binary files will be stored, such as metadata, encoding arrays, and tag array (in chunks).
After constructing the hash table, and populating it with reference k-mers, we need to add taxonomic LCA label to each k-mer for abundance profiling and taxonomic classification. For contamination removal, this step is not needed since matching to any reference sequence is sufficient in that case. Two consecutive commands must be run, and filename and taxonomy look-up files must be given as arguments:
./consult_search -q /path/to/reference_genomes -i /path/to/$LIBRARY_NAME -o . --taxonomy-lookup-path /path/to/taxonomy-lookup --filename-map-path /path/to/filename-map --init-ID
./consult_search -q /path/to/reference_genomes -i /path/to/$LIBRARY_NAME -o . --taxonomy-lookup-path /path/to/taxonomy-lookup --filename-map-path /path/to/filename-map --update-IDAs the name suggests, $LIBRARY_NAME is the name of the library (also the name of the directory), and /path/to/reference_genomes is the path to the directory in which all the reference genomes are stored in FASTQ format separately with appropriate file names.
Note that, filenames are going to be used to map each genome file to a taxon (preferablly species), and parents of each taxon have to be listed in the lookup table.
See the taxonomy lookup and filename map section for a detailed description and instructions for generating them.
The fist command (with the flag --initID) initializes each label associated with k-mers, and counts how many distinct genomes have each k-mer.
Then, the second command (with the flag update-ID) computes and stores the probabilistic soft LCA labels for each k-mer.
Also, make sure to set --thread-count to a value as high as possible because this step might be pretty slow but efficiently parallelized.
To query a set of sequences against a reference library, go to the directory where binaries are and execute the following CONSULT-II command:
./consult_search -i /path/to/$LIBRARY_NAME -q /path/to/query -o /path/to/output_directory
# for example:
./consult_search -q query000.fq -i g000307305_nbr_mapping -o . -c 1The files containing query sequences should be in /path/to/query and in FASTQ format (one uncompressed .fq/.fastq file per each sample).
See section for a detailed description of the query path.
This step is required for all taxonomic identification tasks: classification, profiling, and contamination removal.
But, as described below, different flags have to be used for different tasks, and the above consult_search command is not useful per se.
Classification of reads consists of two stages: i) finding k-mer matches of a given query (with Hamming distances and soft LCA labels) and ii) predicting a taxon based on the matching information.
For the first part run consult_search with the --save-matches flag, which will result in outputting k-mer matches, Hamming distances, and soft LCA labels in a file formatted as described in this section.
See an example command with needed flags below.
./consult_search -i /path/to/$LIBRARY_NAME -q /path/to/query -o /path/to/output_directory taxonomy-lookup-path /path/to/taxonomy-lookup --filename-map-path /path/to/filename-map --save-matches
# for example:
./consult_search -q query000.fq -i g000307305_nbr_mapping --taxonomy-lookup-path taxonomy-lookup --filename-map-path filename-map --save-matchesThen, after obtaining a list of matches with reference k-mers for each query, run consult_classify to summarize matching information with a final classification:
./consult_classify -i /path/to/match-info -o /path/to/output_directory taxonomy-lookup-path /path/to/taxonomy-lookup
# for example:
./consult_classify -i match-info_query000 -o . --taxonomy-lookup-path taxonomy-lookupIf successful, this command will generate a file populated with taxon predictions with corresponding total votes and the classified form of the reads (reverse-complement or original). See the corresponding section for the output format. Filenames are input query filenames prefixed with "classification_", for example, "classification_query000".
Similar to classification, after finding k-mer matches of queries using consult_search with the --save-matches flag, we need to run consult_profile by passing the output of consult_search (in this case matching information) as input.
./consult_profile -i /path/to/match-info -o /path/to/output_directory taxonomy-lookup-path /path/to/taxonomy-lookup
# for example:
./consult_profile -i match-info_query000 -o . --taxonomy-lookup-path taxonomy-lookupThis command will output profile reports to /path/to/output_directory.
There will be independent profile vectors for species, genus, family, class, order, phylum, and kingdom.
Each rank will have its separate profile vector.
Note that, profiles of different ranks do not necessarily agree.
See the corresponding section for the output format.
Filenames are input query filenames prefixed with "profile_" and postfixed with "-" & rank, for example, "profile_query000-genus".
For contamination removal, there is no need to run an additional command: consult_search also is able to generate files that contain the classified reads and unclassified read
To make CONSULT-II behave this way, give the --classified-out and --unclassified-out flags, correspondingly. The output file name will be prefixed with "classified-seq_" and "classified-seq_".
Files are stored in the directory given in /path/to/output_directory, and the current working directory.
Every sample retains its original file name prefixed with "classified-seq_" or "unclassified-seq_".
./consult_search -i $LIBRARY_NAME -q /path/to/query -o /path/to/output_directory --classified-out --unclassified-out --save-distances
# for example:
./consult_search -q query000.fq -i G000307305_nbr_mapping -o . -c 1 --classified-out --unclassified-out --save-distancesAnother output that CONSULT-II can output (with --save-distances flag) is a tab-separated file, in which, each row is a read and the column values are the total numbers of k-mers of that read which matches with some k-mer in the reference library with Hamming distance --maximum-distance. Filenames of the output will be query names prefixed with "kmer-distances_".
Considering the example, unclassified reads would be stored in unclassified-seq_G000307305.fq.
If the flag --classified-out is given, classified reads would be stored in classified-seq_G000307305.fq.
If the flag --save-distances is given, distance values would be stored in kmer-distances_G000307305.fq.
For library construction, CONSULT was designed with Jellyfish's output in mind, which is a FASTA file representing a list of k-mers associated with their counts. We tested with Jellyfish 2.3.0. See the preprocessing section for details on how to generate the input file. Note that CONSULT-II does not use the count values and the only relevant information is the sequence itself. Jellyfish output is pseudo-randomly ordered, and thus, further randomization is not needed. Note that the sequences should not be repeated.
Example FASTA:
> FASTA sequence 1 label
AGACGAGCTTCTTCATCTAAAATGAATTCTCC
> FASTA sequence 2 label
CCAGCTGCATTGATGGTGGGAGTTGGTAAAGG
> FASTA sequence 3 label
GGACCTTGATTTTGACAAGATAGTCGGTAGAC
> FASTA sequence 4 label
ACCACATTTTATACATCGTAAGACAAGCGGCT
The path /path/to/query can be a directory containing .fastq files or a .fastq file.
If it is a directory, each query file in that directory will be queried against the library, and separate outputs will be generated.
FASTA format is not supported at the moment.
Note, if you need to query FASTA files you can convert .fasta/.fa to .fastq/.fq using seqtk seqtk seq -F CHAR command which attaches fake quality scores to the sequences.
Quality factors are not being utilized by CONSULT-II but FASTQ labels will be used to identify the sequences in the output file.
Example FASTQ:
@ FASTQ sequence 1 label
CATCGAGCAGCTATGCAGCTACGAGT
+
-$#'%-#.&)%#)"".)--'*()$)%
@ FASTQ sequence 2 label
TACTGCTGATATTCAGCTCACACC
+
,*#%+#&*$-#,''+*)'&.,).,
A filename map consists of two space-separated columns and a row per genome/file.
The first column is for filenames without their extension, and the second column is for their taxa IDs (species if known).
This file will be used to add taxonomic information (soft LCA labels) with consult_search using --update-ID and --init-ID flags.
Essentially, this is to map reference genomes in /path/to/reference_genomes to taxa, an example row would be as below.
G000307305-k32C_minimized 1214065
Taxonomy lookup is an auxiliary file and it is a lookup table for parents of each taxon. It is essentially the entire taxonomy, but formatted pragmatically. Each row is for a taxon and consists of taxon ID, white space, and a comma-separated list of parents (from bottom to up). Two example rows would look as below.
79885 79885,1386,186817,1385,91061,1239,2
1386 1386,186817,1385,91061,1239,2
Fortunately, we provide a script to create this lookup table from a taxonomy (.dmp file).
Simply run scripts/construct_taxonomy_lookup.py --help to start using the script.
CONSULT-II can report the number of k-mer matches for given query reads in a tab-separated file.
There will be --maximum-distance+1 many columns in addition to read ID and read form (original or reverse complement) columns.
Under each distance column, the number of k-mers matched with some reference k-mers is given.
An example (with --maximum-distance 5) is given below.
READ_ID SEQ_TYPE 0 1 2 3 4 5
@NZ_DF158882.1-8256718 -- 0 0 0 0 0 0
@NZ_DF158882.1-8256718 rc 1 0 0 0 0 0
For classification and profiling, CONSULT-II relies on consult_search's output of detailed information of k-mer matches, consisting of Hamming distance and taxonomic LCA for each k-mer match of a given query.
In this output of consult_search, each query read has three rows: i) read ID, ii) k-mer matches of the original direction and form iii) k-mer matches of the reverse complement.
You can find an example of "match-info_*".
@NZ_DF158883.1-1904898
-- 1214065:0 1214065:0 1214065:0
rc
Here, the read "@NZ_DF158883.1-190489", has three k-mer matches in its original form, and it has no match in its reverse complement form.
All three reference k-mers have the LCA taxon ID "1214065" (Enterobacteriaceae bacterium B14, species level LCA in this case), and the Hamming distances between query k-mers and matched reference k-mers are 0, i.e., we have exact matches.
As it can be easily seen, the format is LCA_TAXON_ID:HAMMING_DISTANCE per k-mer match.
In this case, the total vote for "1214065" would be
Classification reports consist of five tab-separated columns and a row per given query read. The first row is for the read ID, and the second column is to state the form (reverse complement or original) in which the read is classified. Next to them, each row reports the classified taxon ID, the total-vote value of the classified taxon, and the total vote value of the root. An example line from a classification report would look as below.
@NZ_DF158884.1-433795 rc 1214065 1.000000 1.000000
CONSULT-II reports separate profiles for each rank, and each file contains rows for all the taxa estimated to be present in the sample. These reports contain three tab-separated columns: the first column is for taxa IDs, the second column is for taxonomic ranks, and the final column is for abundance value. The abundance value can be interpreted as the total number of reads associated with the corresponding taxon. The sum of abundance values gives the number of reads with at least a single k-mer match. You can simply normalize this column to have a vector whose values sum up to 1. An example is given below.
TAXONOMY_ID TAXONOMY_LEVEL FRACTION_TOTAL
1224 phylum 28472.0000000000
-ior--input-fasta-file: input.fastafile containing canonical k-mers, default length is 35.-oor--output-fasta-file:.fastafile to output minimizers of the given canonical k-mers, default length is 32.
-ior--input-fasta-file: input.fastafile to construct library.-oor--output-library-dir: output path to the directory that will constitute the CONSULT-II library.-hor--number-of-positions: number of randomly positioned bits to compute LSH.-tor--tag-size: number of bits to be used as tag.-lor--number-of-tables: number of tables, i.e., number of hash functions.-bor--column-per-tag: number of columns per each tag partition, i.e., number of k-mers each encoding can map to.
-
-iorinput-library-dir: directory of the CONSULT-II library that will be used as the reference library. -
-ooroutput-result-dir: directory in which all output files (classified and unclassified reads, matching information) will be saved. -
-qor--query-path: the path to the query file, or to the directory containing query files (or reference genomes to add taxonomic information to input library). -
-cor--number-of-matches: the minimum number of matched k-mers that is required to call sequencing read classified. For instance, if at least one k-mer match is enough to classify a read (default setting mentioned in a paper),-cshould be set to 1 in the software. If at least two k-mer matches are required to call the entire read a match,-cshould be set to 2. The default value is 1. -
--thread-count: number of threads to be used, default is 1. -
--unclassified-out: to output reads that are unclassified in a file with a name query file name prefixed with "unclassified-seq_". This is given by default. -
--classified-out: to output reads that are classified in a file with a name query file name prefixed with "classified-seq_". -
--save-distances: to save the number of matched k-mers in a tab-separated file where columns are the distances of corresponding counts. The file name is a query file name prefixed with "kmer-distances_". See the corresponding section. -
--maximum-distance: maximum distance to be included as a column in the file containing k-mer match counts with respect to varying Hamming distance values. Note that, when the--maximum-distancevalue is too large compared to$p$ , CONSULT-II does not necessarily aim to find such k-mers to compute column values. This is because the library size and the corresponding theoretical guarantees only consider$p$ value. So, if one would like to use a large--maximum-distancevalue, the$p$ value should be increased proportionally. -
init-ID: to initialize taxonomic LCA labels (set them to the root of the tree), and to count distinct genomes in which each k-mer appears. -
update-ID: to compute and store probabilistic LCA labels for each k-mer in the reference library. It is required to runconsult_searchwith this flag (and--init-IDbefore classification and profiling. -
--taxonomy-lookup-path: the path of the taxonomic LCA lookup table in a human-readable format. See the corresponding section for details. -
--filename-map-path: the path of the filename/genome to species ID map in a human-readable format. See the corresponding section for details. -
--save-matches: to output detailed k-mer match information of query sequences consisting of Hamming distances and taxonomic LCAs. Output filename convention is query file name prefixed with "kmer-distances_". See the corresponding section for details.
-ior--input-matches-path: path to input match information file, or path to a directory for multiple files. Note that if this is a directory, it should only contain " match-info_" files as it tries to iterate over all files in the directory.-oor--output-predictions-dir: output directory to write classification results for each input query match information. Query names will be prefixed with "classification_".--taxonomy-lookup-path: the path of the taxonomic LCA lookup table in a human-readable format.--thread-count: number of threads to be used, default is 1.
- WoL: Reference Phylogeny for Microbes (bacteria and archaea) (140 Gb - large but performant with defaults)
- WoL: Reference Phylogeny for Microbes (bacteria and archaea) (32 Gb - lighter-weight but still highly accurate)
- WoL: Reference Phylogeny for Microbes (bacteria and archaea) (18 Gb - lightweight and robust)
- Taxonomy lookup tables for all WoL-v1 libraries
Footnotes
-
Şapcı, A.O.B., Rachtman, E., Mirarab, S. (2023). CONSULT-II: Taxonomic Identification Using Locality Sensitive Hashing. In: Jahn, K., Vinař, T. (eds) Comparative Genomics. RECOMB-CG 2023. Lecture Notes in Computer Science, vol 13883. Springer, Cham. https://doi.org/10.1007/978-3-031-36911-7_13 ↩