File tree Expand file tree Collapse file tree
Expand file tree Collapse file tree Original file line number Diff line number Diff line change 1+ cat << 'EOF' > ncbi_blast_search .py
2+ from Bio .Blast import NCBIWWW
3+ from Bio .Blast import NCBIXML
4+ import sys
5+
6+ def execute_remote_blast (sequence_data ):
7+ print ("🚀 Initializing High-Velocity Remote BLAST Query on NCBI Cloud..." )
8+ # Performs a blastn search against the standard nucleotide database (nt)
9+ try :
10+ result_handle = NCBIWWW .qblast ("blastn" , "nt" , sequence_data )
11+ print ("✅ Data stream retrieved. Parsing XML alignment matrix..." )
12+
13+ blast_records = NCBIXML .parse (result_handle )
14+ for record in blast_records :
15+ for alignment in record .alignments [:3 ]: # Isolate top 3 target matches
16+ print (f"\n 🎯 Target Match Alignment: { alignment .title } " )
17+ print (f"🧬 Sequence Length: { alignment .length } Base Pairs" )
18+ for hsp in alignment .hsps :
19+ print (f"📈 Expectation Value (E-value): { hsp .expect } " )
20+ print (f"📊 Query Alignment Sequence: { hsp .query [:50 ]} ..." )
21+ print (f"🔬 Subject Alignment Sequence: { hsp .sbjct [:50 ]} ..." )
22+ except Exception as e :
23+ print (f"❌ Structural Connection Failure: { str (e )} " )
24+
25+ if __name__ == "__main__" :
26+ # Test dataset sequence (Sample DNA Strand segment)
27+ sample_dna = "TGGATTACCAAGTCAATTGGAGAGGCTATTGTTGCTAGC"
28+ execute_remote_blast (sample_dna )
29+ EOF
30+
You can’t perform that action at this time.
0 commit comments