Skip to content

LeahRoberts/DISCus

Repository files navigation

DISCus - DNA Invertible Switch Counter

Simple Overview:

DISCus is a script for mapping illumina paired end reads with BWA to an invertible DNA pseudo-reference and counting read overlap using: (1) Bedops; and (2) read-pairs traversing the desired region.

Basic Commands:

To generate references (requires python v2.7):

$ python DISCus_create_reference.v2.py <file.fasta> <start_coordinate> <end_coordinate> <out_name>

To run DISCus using BWA MEM (in folder with reads with full path to files):

$ bash ~/PATH/TO/DISCus/DISCus_general.v2.bwamem.sh <ref.fasta> <ref.bed> <coordinates.txt>

To run DISCus using minimap2 (in folder with reads with full path to files):

$ bash ~/PATH/TO/DISCus/DISCus_general.v2.minimap.sh <ref.fasta> <ref.bed> <coordinates.txt>

Installation Requirements

  1. BWA MEM version: 0.7.17 (http://sourceforge.net/projects/bio-bwa/files/)
  2. SAMtools version: 1.3.1 (using htslib 1.3.1) (https://sourceforge.net/projects/samtools/files/samtools/)
  3. Bedtools version: 2.23.0 (http://bedtools.readthedocs.org/en/latest/content/installation.html)
  4. Bedops version: 2.4.14 (http://bedops.readthedocs.org/en/latest/content/installation.html)
  5. Python version: 2.7
  6. Biopython version: 1.64 (http://biopython.org/wiki/Main_Page)
  7. minimap2 version 2.11-r797 (https://github.com/lh3/minimap2)

Installation Commands

Installation of the software requirements is dependent on the operating system you are using. Mac OSX and Linux are the most straight-forward. If you are using Windows, we recommend setting up a virtual machine to run Linux on top of your Windows operating system.

BWA and SAMtools installation

Appropriate BWA and SAMtools versions can be downloaded as tar.bz2 files (following the above links). If they are in your downloads folder, we recommend moving them to either a ~/bin directory or to your desktop. Extract them on the command line using:

$ cd <place where you downloaded them>
$ tar jxf <filename>.tar.bz2

Follow the README within each folder for further installation instructions.

BWA and SAMtools will need to be in your $PATH so that DISCus can call them as needed from the command line. To do this, determine the full PATH to your BWA/SAMtools installation and add this to your $PATH:

Open terminal and located where you have installed BWA/SAMtools. In the BWA/SAMtools installation folder:

$ pwd        			# This will give you the full PATH to your BWA/SAMtools installation
$ export PATH=$PATH:</PATH/TO/INSTALLATION/>
$ source ~/.bashrc
$ echo $PATH

Do this for both SAMtools and BWA - when you echo $PATH you should be able to see BWA and SAMtools installation folders. To test that the installation has worked, open a new terminal and type:

$ samtools
$ bwa

The version as well as command line options for the tools should be displayed.

Bedtools and Bedops installation

Bedtools and Bedops can be installed using Homebrew:

$ brew install bedtools
$ brew install bedops

To check installation, type:

$ bedtools
$ bedops

The version as well as command line options for the tools should be displayed.

Python and biopython installation

Mac OSX should come with python installed.

Linux: If you are unfamiliar with the command line, we recommend downloading Anaconda which will install Python, Biopython, plus other common dependencies for data and scientific analysis.

If you don't have Biopython, installation instructions are well documented here.

To check your python and biopython installation, type:

$ python                 # You will see a python prompt
>>> import Bio           # checking for Biopython installation
>>> exit()		 # to exit python prompt

If there were no errors, python and biopython should be installed correctly.

File Requirements

Reference Files (which can be generated with python script):

  1. REFERENCE in fasta format (see below - 'Construction of Reference')
  2. BEDMAP_REFERENCE in bed format (see below - 'Construction of Reference' and 'Construction of Bedmap_reference')
  3. Coordinates file (see below - 'Construction of Reference' and 'Construction of Coordinates File')

Fastq files:

  1. Illumina paired-end read files NOT interleaved (can be gzipped), named: _1.fastq, _2.fastq (see below - Fastq File Format).

Test Data

Step 1. Open terminal. Install all of the necessary software requirements (see above).

Step 2. Download (via zip) or git clone the DISCus repository. We recommend putting DISCus into your ~/bin directory (if you have one):

$ mkdir ~/bin   # if you don't have a bin directory already
$ cd ~/bin     
$ git clone https://github.com/LeahRoberts/DISCus.git

If you have downloaded DISCus as a zip folder, move it from your downloads folder onto your desktop, then in terminal type:

$ mkdir ~/bin  # if you don't have a bin directory already 
$ cd ~/Destop
$ mv ~/Desktop/DISCus/ ~/bin/
$ ls ~/bin     # You should now see DISCus in your bin directory

Step 3. Navigate to where you would like to carry out your analyses (this could be in a work directory, your desktop etc.).

$ cd <directory where you want to work>  

If you're not sure where you want to work, we recommend making a test directory on your desktop (which you can delete later):

$ cd ~/Desktop
$ mkdir DISCus_test
$ cd DISCus_test

Step 4. In your working directory, make another directory called "reads" and download the paired fastq files from EMBL-EBI for the ST131 strains S37EC (ERR161302) and HVM1147 (ERR161318) into the "reads" directory:

$ mkdir reads
$ cd reads
$ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR161/ERR161302/ERR161302_*.fastq.gz
$ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR161/ERR161318/ERR161318_*.fastq.gz

OSX: If wget does not work you may need to install it using homebrew.

Step 5. Generate the reference fasta, bed and coordinate files using the python script DISCus_create_reference.py one directory ABOVE the reads directory:

$ cd ../
$ python ~/bin/DISCus/DISCus_create_reference.py ~/bin/DISCus/References/EC958_complete.fasta 5018228 5018540 EC958_OFF_ON

If you get errors, make sure python and biopython are correctly installed.

Step 6. Check that all the files are present and in the correct directory (4 fastq files in the reads directory, all other files in directory above reads):

$ ls           # in the current directory - should be EC958_OFF_ON.fa, EC958_OFF_ON.bed and coordinates files
$ ls reads/    # should be 4 x fastq files

Step 7. Run DISCus from reads directory:

$ cd reads/
$ bash ~/bin/DISCus/DISCus_general.sh ../EC958_OFF_ON.fa ../EC958_OFF_ON.bed ../EC958_OFF_ON-coordinates.txt

The script will automatically detect the fastq pairs.

The output will be in the form of two csv files containing the results for two separate analyses. To view these on the command line:

$ cat Bedmaps_results.csv
$ cat Paired_read_results.csv

This should give you the following output:

Bedmaps results:

STRAIN,A_1,A_2,B_1,B_2
ERR161302,61,70,3,0
ERR161318,50,34,18,15

Paired_read_results:

ERR161302,39,43,1,0
ERR161318,17,17,8,13

Where A_1 and A_2 indicate reads overlapping the first orientation in the pseudo-reference (OFF), and B_1 and B_2 indicate reads overlapping the second orientation (ON).

As a percentage:

(Bedmaps):

ERR161302 = 98% OFF
ERR161318 = 72% OFF

(Paired Reads):

ERR161302 = 99% OFF
ERR161318 = 62% OFF

DISCus Manual

Introduction:

DISCus is a command-line tool created to interrogate inversion orientation of an invertible DNA region using Illumina paired-end sequencing data. First, a pseudo-reference is generated containing both orientations of a known invertible DNA region with 1 kb of flanking region for each orientation. Illumina paired-end reads are then mapped to this pseudo-reference, where reads will map primarily to whichever orientation was more represented in the bacterial population at the time of sequencing. Two methods are used to quantify the number of reads mapping to either orientation of the invertible region: (1) count the number of reads directly overlapping the unique bordering regions of both orientation, and (2) count the number of paired-reads that traverse from either flanking region to a switch region.

By quantifying the amount of reads mapping to either orientation of a known invertible DNA region, DISCus is able to sensitively quantify the proportion of 'forward' and 'reverse' orientations within a bacterial population.

Construction of Reference

Automated:

The python script, DISCus_create_reference.py, can automatically generate a fasta pseudo-reference, bed file reference and coordinates file for analysis with DISCus using a fasta file of the genome of interest. The script takes in four arguments and can be exected as shown below::

$ python DISCus_create_reference.v2.py <genome_sequence.fasta> <start_coordinate> <end_coordinate> <filename>

Where start_coordinate is the start of the invertible DNA region of interest, and end_coordinate is the end of the invertible DNA region. The script also requires a filename, which will become the name of the output file as well as the fasta header.

The fasta header generated will be::

> <filename>_<start_coordinate>_<end_coordinate>
 Sequence...

The sequence will include 1000 bp of flanking region, as well as both orientations of the invertible DNA region.

Example:

Using the EC958_complete.fasta genome as the input, and wanting a 100 bp inversion region between 182100 and 182200, the command to execute the script would be::

$ python DISCus_create_reference.py EC958_complete.fasta 182100 182200 EC958

Note: the script will not run unless all four arguments are given. The filename argument should be without spaces.

The output of this will be:

  1. a pseudo-reference with the header ">EC958_182100_182200"
  2. a bedmaps reference file indicating 10 bp overlap regions on either end of the invertible DNA region of interest (further explained in "Construction of Bedmap_reference" section)
  3. A coordinates file (txt) defining the regions of the pseudo-reference necessary for determining paired-end read traversal

Manual:

You can also construct the reference manually, as explained below. This section can also serve as further explanation regarding the pseudo-reference and theory of the script.

The REFERENCE will serve as the reference for the read mapping and should be in fasta format.

The REFERENCE should contain the invertible DNA sequence with 1000 bp flanking sequence for both orientations. For example:

------------------>>>>>>>>>>------------------/------------------<<<<<<<<<<------------------

  • ------ = Flanking regions
  • = Invertible DNA sequence, orientation 1

  • <<<<< = Invertible DNA sequence, orientation 2

The flanking sequences remain the same for each orientation, while the invertible DNA switch should be reverse complemented. In this way, both orientations are represented in the REFERENCE.

Construction of Coordinates File:

This process is now automated by a python script, as described above.

In order to count reads traversing the bordering regions of the invertible DNA switch, it is necessary to assign reads to any of 6 regions in the REFERENCE, as in the above figure (you'll notice that there are six regions - 4 flanking regions and 2 invertible switch regions in opposing orientations). Assuming that these orientations are OFF and ON, the six regions are OFF-left-flank, OFF-switch-region, OFF-right-region, and similarly for the ON orientation.

The start and end coordinates for each region is necessary for the assignation of reads to their correct region. Therefore, the script needs to read in a text file with these coordinate. The file needs to be in the below format, with the number changed accordingly::

Region	Start	End
A_left_flank	1	1000
A_switch_region	1001	1313
A_right_flank	1314	2313
B_left_flank	2314	3313
B_switch_region	3314	3626
B_right_flank	3627	4626

The file needs to have a header, and should be tab delimited.

Construction of Bedmap_reference

This process is now automated by a python script, as described above.

The BEDMAP_REFERENCE will specify the location of the desired overlap regions and should be in .bed format.

  • It is very important that the nomenclature stays consistent between the reference sequences, particularly regarding the naming of the reference sequence. i.e. The fasta header for the reference should match that in the .bed file.*

For example, if the reference fasta header looks like this::

>EC958_fimpromoter_off_on_extended
ATAAACATTAAGTTAACCATATCCATACAAAATACAATGGTTTATGTTCTTCAAAATAAA
TAAACAAAATCATTCATAAATTTACACATCACTTAAATTCTCCTGTTTCCGCACTTTTTT
CTTTATTTTTTAAGCAACTGGAAGTTAATCCACTGCAATCTATTGTTATATTGAATCAAA

Then the bed file should look like this::

EC958_fimpromoter_off_on_extended	1001	1011	.	.	+	artemis	exon	.	gene_id=exon:1002..1011
EC958_fimpromoter_off_on_extended	1316	1326	.	.	+	artemis	exon	.	gene_id=exon:1317..1326
EC958_fimpromoter_off_on_extended	3322	3332	.	.	+	artemis	exon	.	gene_id=exon:3323..3332
EC958_fimpromoter_off_on_extended	3637	3647	.	.	+	artemis	exon	.	gene_id=exon:3638..3647

The exons for the DNA switch analysis were created as 10 bp pseudo-exons overlapping each end of the DNA switch regions, totally 4 pseudo-exons regions.

Fastq File Format

For the script to work, the fastq files should be named in a way similar to this::

$name_1.fastq
$name_2.fastq
$name_1.fastq.gz
$name_2.fastq.gz

The read files can be zipped or unzipped.

How-To: Run Me

Simple overview::

$ bash PATH/TO/DISCus_general.v2.[bwamem|minimap].sh <PATH_to_fasta_ref> <PATH_to_bedmaps_ref> <PATH_to_coordinates_file>

This bash scripts requires the reference sequences to have already been generated. Furthermore, the reads (illumina paired end - not interleaved) need to be in a directory below the reference files, and the bash script should be executed in the file containing the reads, according to this diagram:

ScreenShot

Output

The script will generate directories for each strain containing the BAM and BAI files, and the bedmaps results.

Two other files will also be created:

  1. Bedmap_results.csv - The concatenated results for the bedmaps counts of reads overlapping the provided exon locations
  2. Paired_read_results.csv - The concatenated results for the paired-end read counts which traverse the region of interest

NOTE: The script works based on counting the overlapping reads for two orientations of an invertible DNA region. Thus, the input requires a REFERENCE with opposing orientations of an invertible DNA switch, arbitrarily named OFF and ON. The output assumes that the REFERENCE has been designed with OFF orientation first (i.e leftmost - position A_1 and A_2), and the ON orientation second (positions B_1 and B_2).

Licence

All scripts and files within this directory are under the MIT Licence (http://choosealicense.com/licenses/mit/)

About

Invertible DNA switch frequency counter

Resources

License

Stars

2 stars

Watchers

2 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors