Documentation: https://sadie.jordanrwillis.com
Source Code: https://github.com/jwillis0720/sadie
Colab: https://colab.research.google.com/github/jwillis0720/sadie
SADIE is the Sequencing Analysis and Data library for Immunoinformatics Exploration. The key feautures include:
-
Provide pre-built command line applications for popular immunoinformatics applications.
-
Provide a low-level API framework for immunoinformatics developers to build higher level tools.
-
Provide a testable and reusable library that WORKS!
-
Provide a customizable and verified germline reference library.
-
Maintain data formats consistent with standards governed by the AIRR community
-
Portability ready to use out the box.
SADIE is billed as a "complete antibody library", not because it aims to do everything, but because it aims to meet the needs of all immunoinformatics users. SADIE contains both low, mid and high level functionality for immunoinformatics tools and workflows. You can use SADIE as a framework to develop your own tools, use many of the prebuilt contributed tools, or run it in a notebook to enable data exploration. In addition, SADIE aims to port all code to python because relies heavily on the Pandas library, the workhorse of the data science/machine learning age.
Installation is handled using the python package installer pip
$ pip install sadie-antibodyPull requests are highly encouraged here. The development installation uses pre-commit, flake8 linting and black style formatting to maintain code readability and reausability.
$ git clone git@github.com/jwillis0720/sadie.git
$ pip install poetry
$ poetry install --with devConsult the documentation for complete usage. Or checkout our Colab notebook
Annotate antibody sequences only from functional human imgt antibodies to a gzip output
$ sadie airr my_sequence.fastafrom sadie.airr import Airr
# define a single sequence
pg9_seq = """
CAGCGATTAGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGTCGTCCCTGAGACTCTCCTGTGCAGCGT
CCGGATTCGACTTCAGTAGACAAGGCATGCACTGGGTCCGCCAGGCTCCAGGCCAGGGGCTGGAGTGGGT
GGCATTTATTAAATATGATGGAAGTGAGAAATATCATGCTGACTCCGTATGGGGCCGACTCAGCATCTCC
AGAGACAATTCCAAGGATACGCTTTATCTCCAAATGAATAGCCTGAGAGTCGAGGACACGGCTACATATT
TTTGTGTGAGAGAGGCTGGTGGGCCCGACTACCGTAATGGGTACAACTATTACGATTTCTATGATGGTTA
TTATAACTACCACTATATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCGAGC""".replace(
"\n", ""
)
# initialize the api
air_api = Airr("human")
# run single sequence string
airr_table = air_api.run_single("PG9", pg9_seq)- Copyright © Jordan R. Willis, Troy M. Sincomb & Caleb K. Kibet