Skip to content

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

71 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

miRBind 2.0

Deep-learning models for predicting miRNA–mRNA interactions.

This repository ships two models:

  • Pairwise binding-site model — a CNN that predicts whether a given miRNA binds a given target site (≈50 nt window). Use this to score candidate binding sites.
  • Gene-level repression model — predicts the gene-level fold change a miRNA induces from a full 3'UTR sequence. Built on top of the binding-site model via transfer learning.

Installation

Clone the repo and install the dependencies (Python ≥ 3.9, PyTorch ≥ 1.9):

git clone https://github.com/BioGeMT/miRBind_2.0.git
cd miRBind_2.0
pip install -r code/pairwise_binding_site_model/requirements.txt

A GPU is recommended but not required — the models will fall back to CPU automatically.

Quick start: predicting miRNA binding sites

The trained binding-site model is included in models/pairwise_onehot_model_20260105_200141.pt.

1. Prepare your input

A TSV file with at minimum these columns:

column 0 (target/mRNA) column 1 (miRNA) label
TTTTTTTT...GACAGTGG TGTGCAAATCTATGCAAAACTGA 0

The label column is required by the data loader but is ignored at inference. Set it to 0 if you don't have ground truth. A small example is provided in data/chimeric_datasets/sample_dataset/.

2. Run inference

cd code/pairwise_binding_site_model

python -m inference.predict \
    --model_path ../../models/pairwise_onehot_model_20260105_200141.pt \
    --input_file path/to/your_sites.tsv \
    --output_file predictions.tsv \
    --model_type pairwise_onehot \
    --batch_size 32

The output TSV is your input plus two columns:

  • prediction_score — binding probability in [0, 1]
  • predicted_class — 1 if prediction_score > 0.5, else 0

There is also a ready-to-edit wrapper script at analysis/pairwise_binding_site_model/inference.sh.

Quick start: predicting gene-level repression

See analysis/gene_level_model/README.md for the full walkthrough. Briefly:

# install gene-level model dependencies
pip install -r analysis/gene_level_model/requirements.txt

# download the training/eval data
bash analysis/gene_level_model/download_data.sh

# evaluate on a test set (or train your own — see analysis/gene_level_model/train.sh)
bash analysis/gene_level_model/evaluate.sh

The gene-level model takes a full 3'UTR sequence (up to several thousand nt) and a miRNA sequence and predicts a scalar fold change.

Explainability

The binding-site model supports SHAP-based attribution (via Captum's GradientShap). See code/pairwise_binding_site_model/README.md for the SHAP, clustering, and aggregation pipelines.

Downloading the public datasets

To reproduce the published results or train from scratch:

bash data/scripts/run_zenodo_downloader.sh

This pulls the AGO2 eCLIP Manakov 2022 train / test / leftout splits from Zenodo into data/chimeric_datasets/.

Repository layout

  • code/ — model definitions, encoders, training and inference scripts.
  • analysis/ — runnable wrapper scripts (train.sh, inference.sh, etc.) for each model.
  • data/ — placeholder; populated by the download scripts above.
  • models/ — trained model checkpoints.

Models leaderboard

We track model performance on the Manakov22 test and leftout datasets, ranked by Average Precision score (AP) AP(test) + AP(leftout).

Rank Model AP(test) AP(leftout) Model Code Date Authors
1 Pairwise encoding with conservation (+2 channels) 85.93 82.26 model code 2025-03-27 Dimos, David, Panos
2 Pairwise encoding CNN 84.97 83.08 model code 2025-03-19 David, Panos
3 Retrained miRBind CNN (miRBench) 84.00 81.00 2025-03-19 Eva
4 TargetScanCNN 77.00 76.00 2025-03-19 TargetScan

Transcript repression predictions

Transcript repression predictions stored on Google Drive

Citation

If you use miRBind 2.0 in your work, please cite the corresponding manuscript: miRBind2 enables sequence-only prediction of miRNA binding and transcript repression.

About

Working Repository for the MiRbind 2.0 project

Resources

Contributing

Stars

Watchers

Forks

Releases

Packages

Used by

Contributors

Languages