diff --git a/.vscode/extensions.json b/.vscode/extensions.json
new file mode 100644
index 0000000..d5cdfea
--- /dev/null
+++ b/.vscode/extensions.json
@@ -0,0 +1,5 @@
+{
+  "recommendations": [
+    "oxc.oxc-vscode"
+  ]
+}
diff --git a/.vscode/settings.json b/.vscode/settings.json
new file mode 100644
index 0000000..e5bdb6c
--- /dev/null
+++ b/.vscode/settings.json
@@ -0,0 +1,40 @@
+{
+  "editor.defaultFormatter": "oxc.oxc-vscode",
+  "[typescript]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[vue]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[javascript]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[css]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[scss]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[html]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[yaml]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[markdown]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "[json]": {
+    "editor.defaultFormatter": "oxc.oxc-vscode",
+    "editor.tabSize": 2
+  },
+  "typescript.tsdk": "./node_modules/typescript/lib"
+}
diff --git a/model/.oxfmtrc.json b/model/.oxfmtrc.json
new file mode 100644
index 0000000..ba9bb8f
--- /dev/null
+++ b/model/.oxfmtrc.json
@@ -0,0 +1,3 @@
+{
+  "ignorePatterns": ["dist", "CHANGELOG.md"]
+}
diff --git a/model/.oxlintrc.json b/model/.oxlintrc.json
new file mode 100644
index 0000000..70ab6b8
--- /dev/null
+++ b/model/.oxlintrc.json
@@ -0,0 +1,3 @@
+{
+  "extends": ["node_modules/@milaboratories/ts-builder/dist/configs/oxlint-block-model.json"]
+}
diff --git a/model/eslint.config.mjs b/model/eslint.config.mjs
deleted file mode 100644
index 0c8c7ff..0000000
--- a/model/eslint.config.mjs
+++ /dev/null
@@ -1,4 +0,0 @@
-import { model } from '@platforma-sdk/eslint-config';
-
-/** @type {import('eslint').Linter.Config[]} */
-export default [...model];
\ No newline at end of file
diff --git a/model/package.json b/model/package.json
index 907f3a6..df13805 100644
--- a/model/package.json
+++ b/model/package.json
@@ -7,17 +7,17 @@
   "types": "dist/index.d.ts",
   "exports": {
     ".": {
+      "types": "./dist/index.d.ts",
       "sources": "./src/index.ts",
-      "import": "./dist/index.js",
-      "types": "./dist/index.d.ts"
+      "import": "./dist/index.js"
     },
     "./dist/*": "./dist/*"
   },
   "scripts": {
-    "lint": "eslint .",
+    "fmt": "ts-builder format",
+    "check": "ts-builder check --target block-model",
     "watch": "ts-builder build --target block-model --watch",
     "build": "ts-builder build --target block-model && block-tools build-model",
-    "type-check": "ts-builder type-check --target block-model",
     "test": "vitest --run --passWithNoTests",
     "do-pack": "rm -f *.tgz && pnpm pack && mv *.tgz package.tgz"
   },
@@ -31,7 +31,7 @@
     "@platforma-sdk/block-tools": "catalog:",
     "@platforma-sdk/eslint-config": "catalog:",
     "eslint": "catalog:",
-    "vitest": "catalog:",
-    "typescript": "catalog:"
+    "typescript": "catalog:",
+    "vitest": "catalog:"
   }
 }
diff --git a/model/src/index.ts b/model/src/index.ts
index d616d4b..02e1dde 100644
--- a/model/src/index.ts
+++ b/model/src/index.ts
@@ -1,4 +1,9 @@
-import type { ImportFileHandle, InferHrefType, PlDataTableStateV2, PlRef } from '@platforma-sdk/model';
+import type {
+  ImportFileHandle,
+  InferHrefType,
+  PlDataTableStateV2,
+  PlRef,
+} from "@platforma-sdk/model";
 import {
   BlockModel,
   createPlDataTableStateV2,
@@ -6,13 +11,13 @@ import {
   isPColumnSpec,
   parseResourceMap,
   type InferOutputsType,
-} from '@platforma-sdk/model';
-import { ProgressPrefix } from './progress';
+} from "@platforma-sdk/model";
+import { ProgressPrefix } from "./progress";
 
-export type CloneClusteringMode = 'relaxed' | 'default' | 'off';
+export type CloneClusteringMode = "relaxed" | "default" | "off";
 export type AssemblingFeature = string;
-export type StopCodonType = 'amber' | 'ochre' | 'opal';
-export type ReferenceInputMode = 'fastaFile' | 'fastaSequence' | 'libraryFile' | 'buildLibrary';
+export type StopCodonType = "amber" | "ochre" | "opal";
+export type ReferenceInputMode = "fastaFile" | "fastaSequence" | "libraryFile" | "buildLibrary";
 
 export interface VAnchorPoints {
   fr1Begin: number;
@@ -85,101 +90,105 @@ export interface BlockArgsValid extends BlockArgs {
   librarySequence: string;
 }
 
-export const platforma = BlockModel.create('Heavy')
+export const platforma = BlockModel.create("Heavy")
 
   .withArgs<BlockArgs>({
-    defaultBlockLabel: '',
-    customBlockLabel: '',
-    chains: 'IGHeavy',
-    cloneClusteringMode: 'relaxed',
-    tagPattern: '',
-    assemblingFeature: 'VDJRegion',
+    defaultBlockLabel: "",
+    customBlockLabel: "",
+    chains: "IGHeavy",
+    cloneClusteringMode: "relaxed",
+    tagPattern: "",
+    assemblingFeature: "VDJRegion",
     imputeGermline: false,
   })
   .withUiState<UiState>({
-    referenceInputMode: 'fastaSequence',
+    referenceInputMode: "fastaSequence",
     tableState: createPlDataTableStateV2(),
   })
 
-  .output('qc', (ctx) => {
-    const acc = ctx.outputs?.resolve('qc');
+  .output("qc", (ctx) => {
+    const acc = ctx.outputs?.resolve("qc");
     if (!acc || !acc.getInputsLocked()) return undefined;
     return parseResourceMap(acc, (acc) => acc.getFileHandle(), true);
   })
 
-  .output('reports', (ctx) =>
-    parseResourceMap(
-      ctx.outputs?.resolve('reports'),
-      (acc) => acc.getFileHandle(),
-      false,
-    ),
+  .output("reports", (ctx) =>
+    parseResourceMap(ctx.outputs?.resolve("reports"), (acc) => acc.getFileHandle(), false),
   )
 
-  .output('logs', (ctx) => {
+  .output("logs", (ctx) => {
     return ctx.outputs !== undefined
-      ? parseResourceMap(
-          ctx.outputs?.resolve('logs'),
-          (acc) => acc.getLogHandle(),
-          false,
-        )
+      ? parseResourceMap(ctx.outputs?.resolve("logs"), (acc) => acc.getLogHandle(), false)
       : undefined;
   })
 
-  .output('progress', (ctx) => {
+  .output("progress", (ctx) => {
     return ctx.outputs !== undefined
       ? parseResourceMap(
-          ctx.outputs?.resolve('logs'),
+          ctx.outputs?.resolve("logs"),
           (acc) => acc.getProgressLog(ProgressPrefix),
           false,
         )
       : undefined;
   })
 
-  .output('referenceLibrary', (ctx) => {
+  .output("referenceLibrary", (ctx) => {
     return ctx.outputs !== undefined
-      ? ctx.outputs?.resolve({ field: 'referenceLibrary', assertFieldType: 'Input', allowPermanentAbsence: true })?.getRemoteFileHandle()
+      ? ctx.outputs
+          ?.resolve({
+            field: "referenceLibrary",
+            assertFieldType: "Input",
+            allowPermanentAbsence: true,
+          })
+          ?.getRemoteFileHandle()
       : undefined;
   })
 
-  .output('debugOutput', (ctx) => {
+  .output("debugOutput", (ctx) => {
     return ctx.outputs !== undefined
-      ? ctx.outputs?.resolve({ field: 'debugOutput', assertFieldType: 'Input', allowPermanentAbsence: true })?.getLogHandle()
+      ? ctx.outputs
+          ?.resolve({ field: "debugOutput", assertFieldType: "Input", allowPermanentAbsence: true })
+          ?.getLogHandle()
       : undefined;
   })
 
-  .output('started', (ctx) => ctx.outputs !== undefined)
+  .output("started", (ctx) => ctx.outputs !== undefined)
 
-  .output('done', (ctx) => {
+  .output("done", (ctx) => {
     return ctx.outputs !== undefined
-      ? parseResourceMap(
-          ctx.outputs?.resolve('clns'),
-          (_acc) => true,
-          false,
-        ).data.map((e) => e.key[0] as string)
+      ? parseResourceMap(ctx.outputs?.resolve("clns"), (_acc) => true, false).data.map(
+          (e) => e.key[0] as string,
+        )
       : undefined;
   })
 
-  .output('prerunLibrary', (ctx) =>
-    ctx.prerun?.resolve({ field: 'referenceLibrary', assertFieldType: 'Input', allowPermanentAbsence: true })?.getFileHandle(),
+  .output("prerunLibrary", (ctx) =>
+    ctx.prerun
+      ?.resolve({
+        field: "referenceLibrary",
+        assertFieldType: "Input",
+        allowPermanentAbsence: true,
+      })
+      ?.getFileHandle(),
   )
 
-  .retentiveOutput('inputOptions', (ctx) => {
+  .retentiveOutput("inputOptions", (ctx) => {
     return ctx.resultPool.getOptions((v) => {
       if (!isPColumnSpec(v)) return false;
       const domain = v.domain;
       return (
-        v.name === 'pl7.app/sequencing/data'
-        && (v.valueType as string) === 'File'
-        && domain !== undefined
-        && (domain['pl7.app/fileExtension'] === 'fasta'
-          || domain['pl7.app/fileExtension'] === 'fasta.gz'
-          || domain['pl7.app/fileExtension'] === 'fastq'
-          || domain['pl7.app/fileExtension'] === 'fastq.gz')
+        v.name === "pl7.app/sequencing/data" &&
+        (v.valueType as string) === "File" &&
+        domain !== undefined &&
+        (domain["pl7.app/fileExtension"] === "fasta" ||
+          domain["pl7.app/fileExtension"] === "fasta.gz" ||
+          domain["pl7.app/fileExtension"] === "fastq" ||
+          domain["pl7.app/fileExtension"] === "fastq.gz")
       );
     });
   })
 
-  .output('sampleLabels', (ctx): Record<string, string> | undefined => {
+  .output("sampleLabels", (ctx): Record<string, string> | undefined => {
     const inputRef = ctx.args.datasetRef;
     if (inputRef === undefined) return undefined;
 
@@ -189,71 +198,79 @@ export const platforma = BlockModel.create('Heavy')
     return ctx.resultPool.findLabelsForColumnAxis(spec, 0);
   })
 
-  .output('rawTsvs', (ctx) => {
-    if (ctx.outputs === undefined)
-      return undefined;
-    const pCols = ctx.outputs?.resolve('clonotypeTables')?.getPColumns();
+  .output("rawTsvs", (ctx) => {
+    if (ctx.outputs === undefined) return undefined;
+    const pCols = ctx.outputs?.resolve("clonotypeTables")?.getPColumns();
     if (pCols === undefined) {
       return undefined;
     }
-    return pCols.map((pCol) => {
-      return {
-        ...pCol,
-        id: (JSON.parse(pCol.id) as { name: string }).name,
-        data: parseResourceMap(pCol.data, (acc) => acc.getRemoteFileHandle(), false),
-      };
-    }).filter((pCol) => pCol.data.isComplete).map((pCol) => {
-      return {
-        ...pCol,
-        data: pCol.data.data,
-      };
-    });
+    return pCols
+      .map((pCol) => {
+        return {
+          ...pCol,
+          id: (JSON.parse(pCol.id) as { name: string }).name,
+          data: parseResourceMap(pCol.data, (acc) => acc.getRemoteFileHandle(), false),
+        };
+      })
+      .filter((pCol) => pCol.data.isComplete)
+      .map((pCol) => {
+        return {
+          ...pCol,
+          data: pCol.data.data,
+        };
+      });
   })
 
-  .outputWithStatus('pt', (ctx) => {
-    const pCols = ctx.outputs?.resolve({ field: 'qcReportTable', assertFieldType: 'Input', allowPermanentAbsence: true })?.getPColumns();
+  .outputWithStatus("pt", (ctx) => {
+    const pCols = ctx.outputs
+      ?.resolve({ field: "qcReportTable", assertFieldType: "Input", allowPermanentAbsence: true })
+      ?.getPColumns();
     if (pCols === undefined) {
       return undefined;
     }
-    return createPlDataTableV2(
-      ctx,
-      pCols,
-      ctx.uiState.tableState,
-    );
+    return createPlDataTableV2(ctx, pCols, ctx.uiState.tableState);
   })
 
   .sections((_ctx) => {
     return [
-      { type: 'link', href: '/', label: 'Main' },
-      { type: 'link', href: '/qc-report-table', label: 'QC Report Table' },
+      { type: "link", href: "/", label: "Main" },
+      { type: "link", href: "/qc-report-table", label: "QC Report Table" },
     ];
   })
 
   .argsValid((ctx) => {
-    const mode = ctx.uiState.referenceInputMode ?? 'fastaSequence';
+    const mode = ctx.uiState.referenceInputMode ?? "fastaSequence";
     const hasDataset = ctx.args.datasetRef !== undefined;
-    if (mode === 'libraryFile') {
+    if (mode === "libraryFile") {
       return hasDataset && ctx.args.libraryFile !== undefined;
     }
-    if (mode === 'buildLibrary') {
+    if (mode === "buildLibrary") {
       return hasDataset && (ctx.args.libraryEntries?.length ?? 0) > 0;
     }
-    return hasDataset && (ctx.uiState.librarySequence !== undefined || ctx.args.vGenes !== undefined);
+    return (
+      hasDataset && (ctx.uiState.librarySequence !== undefined || ctx.args.vGenes !== undefined)
+    );
   })
 
-  .output('isRunning', (ctx) => ctx.outputs?.getIsReadyOrError() === false)
+  .output("isRunning", (ctx) => ctx.outputs?.getIsReadyOrError() === false)
 
-  .output('libraryUploadProgress', (ctx) =>
-    ctx.outputs?.resolve({ field: 'libraryImportHandle', allowPermanentAbsence: true })?.getImportProgress(), { isActive: true })
+  .output(
+    "libraryUploadProgress",
+    (ctx) =>
+      ctx.outputs
+        ?.resolve({ field: "libraryImportHandle", allowPermanentAbsence: true })
+        ?.getImportProgress(),
+    { isActive: true },
+  )
 
-  .title(() => 'MiXCR Amplicon Alignment')
+  .title(() => "MiXCR Amplicon Alignment")
 
-  .subtitle((ctx) => ctx.args.customBlockLabel || ctx.args.defaultBlockLabel || '')
+  .subtitle((ctx) => ctx.args.customBlockLabel || ctx.args.defaultBlockLabel || "")
 
   .done(2);
 
 export type BlockOutputs = InferOutputsType<typeof platforma>;
 export type Href = InferHrefType<typeof platforma>;
-export * from './progress';
-export * from './qc';
-export * from './reports';
+export * from "./progress";
+export * from "./qc";
+export * from "./reports";
diff --git a/model/src/progress.ts b/model/src/progress.ts
index 040b307..63b6bb4 100644
--- a/model/src/progress.ts
+++ b/model/src/progress.ts
@@ -1,3 +1,4 @@
-export const ProgressPrefix = '[==PROGRESS==]';
+export const ProgressPrefix = "[==PROGRESS==]";
 
-export const ProgressPattern = /(?<stage>[^:]*):(?: *(?<progress>[0-9.]+)%)?(?: *ETA: *(?<eta>.+))?/;
+export const ProgressPattern =
+  /(?<stage>[^:]*):(?: *(?<progress>[0-9.]+)%)?(?: *ETA: *(?<eta>.+))?/;
diff --git a/model/src/qc.ts b/model/src/qc.ts
index 7001f47..2bc2fe9 100644
--- a/model/src/qc.ts
+++ b/model/src/qc.ts
@@ -1,10 +1,6 @@
-import { z } from 'zod';
+import { z } from "zod";
 
-export const QcStatus = z.union([
-  z.literal('OK'),
-  z.literal('WARN'),
-  z.literal('ALERT'),
-]);
+export const QcStatus = z.union([z.literal("OK"), z.literal("WARN"), z.literal("ALERT")]);
 
 export const QcCheck = z.object({
   type: z.string(),
diff --git a/model/src/reports.ts b/model/src/reports.ts
index 5e78a19..c75c620 100644
--- a/model/src/reports.ts
+++ b/model/src/reports.ts
@@ -1,79 +1,79 @@
-import { z } from 'zod';
+import { z } from "zod";
 
 export const ImmuneChain = z.union([
-  z.literal(''),
-  z.literal('TRA'),
-  z.literal('TRAD'),
-  z.literal('TRB'),
-  z.literal('TRG'),
-  z.literal('TRD'),
-  z.literal('IGH'),
-  z.literal('IGK'),
-  z.literal('IGL'),
+  z.literal(""),
+  z.literal("TRA"),
+  z.literal("TRAD"),
+  z.literal("TRB"),
+  z.literal("TRG"),
+  z.literal("TRD"),
+  z.literal("IGH"),
+  z.literal("IGK"),
+  z.literal("IGL"),
 ]);
 
 export type ImmuneChain = z.infer<typeof ImmuneChain>;
 
 export const NotAlignedReason = z.union([
-  z.literal('NoHits'),
-  z.literal('FailedAfterAOverlap'),
-  z.literal('NoCDR3Parts'),
-  z.literal('NoVHits'),
-  z.literal('NoJHits'),
-  z.literal('VAndJOnDifferentTargets'),
-  z.literal('LowTotalScore'),
-  z.literal('NoBarcode'),
-  z.literal('SampleNotMatched'),
+  z.literal("NoHits"),
+  z.literal("FailedAfterAOverlap"),
+  z.literal("NoCDR3Parts"),
+  z.literal("NoVHits"),
+  z.literal("NoJHits"),
+  z.literal("VAndJOnDifferentTargets"),
+  z.literal("LowTotalScore"),
+  z.literal("NoBarcode"),
+  z.literal("SampleNotMatched"),
 ]);
 export type NotAlignedReason = z.infer<typeof NotAlignedReason>;
 
 export const AlignmentChannel = z.union([
-  z.literal('Success'),
-  z.literal('NoHits'),
-  z.literal('NoCDR3Parts'),
-  z.literal('NoVHits'),
-  z.literal('NoJHits'),
-  z.literal('VAndJOnDifferentTargets'),
-  z.literal('LowTotalScore'),
-  z.literal('NoBarcode'),
+  z.literal("Success"),
+  z.literal("NoHits"),
+  z.literal("NoCDR3Parts"),
+  z.literal("NoVHits"),
+  z.literal("NoJHits"),
+  z.literal("VAndJOnDifferentTargets"),
+  z.literal("LowTotalScore"),
+  z.literal("NoBarcode"),
 ]);
 export type AlignmentChannel = z.infer<typeof AlignmentChannel>;
 
 export const AlignmentChannels = [
-  'Success',
-  'NoHits',
-  'NoCDR3Parts',
-  'NoVHits',
-  'NoJHits',
-  'VAndJOnDifferentTargets',
-  'LowTotalScore',
-  'NoBarcode',
+  "Success",
+  "NoHits",
+  "NoCDR3Parts",
+  "NoVHits",
+  "NoJHits",
+  "VAndJOnDifferentTargets",
+  "LowTotalScore",
+  "NoBarcode",
 ] satisfies AlignmentChannel[];
 
 export const AlignmentChannelLabels = {
-  Success: 'Successfully aligned',
-  NoHits: 'No hits (not TCR/IG?)',
-  FailedAfterAOverlap: 'Failed after alignment-overlap',
-  NoCDR3Parts: 'No CDR3 parts',
-  NoVHits: 'No V hits',
-  NoJHits: 'No J hits',
-  VAndJOnDifferentTargets: 'No target with both V and J',
-  LowTotalScore: 'Low total score',
-  NoBarcode: 'Absent barcode',
-  SampleNotMatched: 'Sample not matched',
+  Success: "Successfully aligned",
+  NoHits: "No hits (not TCR/IG?)",
+  FailedAfterAOverlap: "Failed after alignment-overlap",
+  NoCDR3Parts: "No CDR3 parts",
+  NoVHits: "No V hits",
+  NoJHits: "No J hits",
+  VAndJOnDifferentTargets: "No target with both V and J",
+  LowTotalScore: "Low total score",
+  NoBarcode: "Absent barcode",
+  SampleNotMatched: "Sample not matched",
 } satisfies Record<NotAlignedReason | AlignmentChannel, string>;
 
 export const AlignmentChannelColors = {
-  Success: '#6BD67D',
-  NoHits: '#FEE27A',
-  FailedAfterAOverlap: 'red',
-  NoCDR3Parts: '#FEBF51',
-  NoVHits: '#FB9361',
-  NoJHits: '#E75B64',
-  VAndJOnDifferentTargets: '#B8397A',
-  LowTotalScore: '#7E2583',
-  NoBarcode: '#4B1979',
-  SampleNotMatched: '#2B125C',
+  Success: "#6BD67D",
+  NoHits: "#FEE27A",
+  FailedAfterAOverlap: "red",
+  NoCDR3Parts: "#FEBF51",
+  NoVHits: "#FB9361",
+  NoJHits: "#E75B64",
+  VAndJOnDifferentTargets: "#B8397A",
+  LowTotalScore: "#7E2583",
+  NoBarcode: "#4B1979",
+  SampleNotMatched: "#2B125C",
 } satisfies Record<NotAlignedReason | AlignmentChannel, string>;
 
 const ChainUsageEntry = z.object({
@@ -90,7 +90,7 @@ const ChainUsage = z.object({
 });
 
 export const AlignReport = z.object({
-  type: z.literal('alignerReport'),
+  type: z.literal("alignerReport"),
   totalReadsProcessed: z.number().int(),
   aligned: z.number().int(),
   notAligned: z.number().int(),
@@ -112,11 +112,9 @@ export const AlignReport = z.object({
 });
 export type AlignReport = z.infer<typeof AlignReport>;
 
-export function extractAlignmentChannels(
-  report: AlignReport,
-): [AlignmentChannel, number][] {
+export function extractAlignmentChannels(report: AlignReport): [AlignmentChannel, number][] {
   return AlignmentChannels.map((cId) => [
     cId,
-    cId === 'Success' ? report.aligned : report.notAlignedReasons[cId] ?? 0,
+    cId === "Success" ? report.aligned : (report.notAlignedReasons[cId] ?? 0),
   ]);
 }
diff --git a/model/vitest.config.mts b/model/vitest.config.mts
index 49a0dd8..609455d 100644
--- a/model/vitest.config.mts
+++ b/model/vitest.config.mts
@@ -1,7 +1,7 @@
-import { defineConfig } from 'vitest/config';
+import { defineConfig } from "vitest/config";
 
 export default defineConfig({
   test: {
-    watch: false
-  }
+    watch: false,
+  },
 });
diff --git a/package.json b/package.json
index 399b3c8..5e8e2bc 100644
--- a/package.json
+++ b/package.json
@@ -1,9 +1,9 @@
 {
   "scripts": {
+    "fmt": "turbo run fmt",
+    "check": "turbo run check",
     "build": "turbo run build",
     "build:dev": "env PL_PKG_DEV=local turbo run build",
-    "lint": "turbo run lint",
-    "type-check": "turbo run type-check",
     "test": "env PL_PKG_DEV=local turbo run test --concurrency 1 --env-mode=loose",
     "test:dry-run": "env PL_PKG_DEV=local turbo run test --dry-run=json",
     "mark-stable": "turbo run mark-stable",
@@ -14,10 +14,15 @@
     "update-sdk": "block-tools update-deps"
   },
   "devDependencies": {
+    "@milaboratories/ts-builder": "catalog:",
     "@changesets/cli": "catalog:",
     "@platforma-sdk/block-tools": "catalog:",
     "turbo": "catalog:",
     "typescript": "catalog:"
   },
-  "packageManager": "pnpm@9.12.0"
-}
\ No newline at end of file
+  "packageManager": "pnpm@9.12.0",
+  "peerDependencies": {
+    "oxlint": "*",
+    "oxfmt": "*"
+  }
+}
diff --git a/pnpm-lock.yaml b/pnpm-lock.yaml
index 8c3bcfc..7443202 100644
--- a/pnpm-lock.yaml
+++ b/pnpm-lock.yaml
@@ -88,10 +88,20 @@ catalogs:
 importers:
 
   .:
+    dependencies:
+      oxfmt:
+        specifier: '*'
+        version: 0.35.0
+      oxlint:
+        specifier: '*'
+        version: 1.43.0
     devDependencies:
       '@changesets/cli':
         specifier: 'catalog:'
         version: 2.29.8(@types/node@25.0.2)
+      '@milaboratories/ts-builder':
+        specifier: 'catalog:'
+        version: 1.3.0(@types/node@25.0.2)(esbuild@0.27.1)(rollup@4.53.4)(vue@3.5.25(typescript@5.6.3))(yaml@2.8.2)
       '@platforma-sdk/block-tools':
         specifier: 'catalog:'
         version: 2.6.70
diff --git a/test/.oxfmtrc.json b/test/.oxfmtrc.json
new file mode 100644
index 0000000..ba9bb8f
--- /dev/null
+++ b/test/.oxfmtrc.json
@@ -0,0 +1,3 @@
+{
+  "ignorePatterns": ["dist", "CHANGELOG.md"]
+}
diff --git a/test/.oxlintrc.json b/test/.oxlintrc.json
new file mode 100644
index 0000000..b1a1390
--- /dev/null
+++ b/test/.oxlintrc.json
@@ -0,0 +1,3 @@
+{
+  "extends": ["node_modules/@milaboratories/ts-builder/dist/configs/oxlint-node.json"]
+}
diff --git a/test/eslint.config.mjs b/test/eslint.config.mjs
deleted file mode 100644
index bf5dbe7..0000000
--- a/test/eslint.config.mjs
+++ /dev/null
@@ -1,4 +0,0 @@
-import { test } from '@platforma-sdk/eslint-config';
-
-/** @type {import('eslint').Linter.Config[]} */
-export default [...test];
diff --git a/test/package.json b/test/package.json
index 124f604..d745710 100644
--- a/test/package.json
+++ b/test/package.json
@@ -1,22 +1,22 @@
 {
   "name": "@platforma-open/milaboratories.mixcr-amplicon-alignment.test",
-  "private": true,
   "version": "1.7.10",
+  "private": true,
   "description": "MiXCR Amplicon Alignment Tests",
+  "keywords": [],
+  "files": [],
   "type": "module",
   "scripts": {
+    "fmt": "ts-builder format",
     "test": "vitest --run --passWithNoTests",
-    "lint": "eslint .",
-    "type-check": "ts-builder type-check --target block-test"
+    "check": "ts-builder check --target block-test"
   },
-  "files": [],
-  "keywords": [],
   "dependencies": {
-    "this-block": "workspace:@platforma-open/milaboratories.mixcr-amplicon-alignment@*",
     "@platforma-open/milaboratories.mixcr-amplicon-alignment.model": "workspace:*",
-    "@platforma-open/milaboratories.samples-and-data.model": "catalog:",
     "@platforma-open/milaboratories.samples-and-data": "catalog:",
-    "@platforma-sdk/model": "catalog:"
+    "@platforma-open/milaboratories.samples-and-data.model": "catalog:",
+    "@platforma-sdk/model": "catalog:",
+    "this-block": "workspace:@platforma-open/milaboratories.mixcr-amplicon-alignment@*"
   },
   "devDependencies": {
     "@milaboratories/ts-builder": "catalog:",
@@ -27,4 +27,4 @@
     "typescript": "catalog:",
     "vitest": "catalog:"
   }
-}
\ No newline at end of file
+}
diff --git a/test/src/alignmentChartSettings.test.ts b/test/src/alignmentChartSettings.test.ts
index 1cc414e..f1ec4a4 100644
--- a/test/src/alignmentChartSettings.test.ts
+++ b/test/src/alignmentChartSettings.test.ts
@@ -1,10 +1,10 @@
-import { test, expect } from 'vitest';
-import type { AlignReport } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
+import { test, expect } from "vitest";
+import type { AlignReport } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
 
 // Test the core logic without importing UI components
-test('alignment chart data extraction logic', () => {
+test("alignment chart data extraction logic", () => {
   const mockAlignReport: Partial<AlignReport> = {
-    type: 'alignerReport',
+    type: "alignerReport",
     totalReadsProcessed: 1000,
     aligned: 850,
     notAligned: 150,
@@ -28,7 +28,9 @@ test('alignment chart data extraction logic', () => {
     const aligned = alignReport.aligned || 0;
     const notAlignedReasons = alignReport.notAlignedReasons || {};
 
-    const result: Array<{ category: string; value: number }> = [{ category: 'Success', value: aligned }];
+    const result: Array<{ category: string; value: number }> = [
+      { category: "Success", value: aligned },
+    ];
 
     // Add not aligned reasons
     for (const [reason, count] of Object.entries(notAlignedReasons)) {
@@ -45,12 +47,12 @@ test('alignment chart data extraction logic', () => {
   expect(result).toHaveLength(10); // Success + 9 not aligned reasons
 
   // Check that Success category exists and has correct value
-  const successCategory = result.find((item) => item.category === 'Success');
+  const successCategory = result.find((item) => item.category === "Success");
   expect(successCategory).toBeDefined();
   expect(successCategory?.value).toBe(850);
 
   // Check that NoHits category exists and has correct value
-  const noHitsCategory = result.find((item) => item.category === 'NoHits');
+  const noHitsCategory = result.find((item) => item.category === "NoHits");
   expect(noHitsCategory).toBeDefined();
   expect(noHitsCategory?.value).toBe(50);
 
@@ -60,7 +62,7 @@ test('alignment chart data extraction logic', () => {
   });
 });
 
-test('alignment chart data extraction with undefined report', () => {
+test("alignment chart data extraction with undefined report", () => {
   const extractAlignmentData = (alignReport: Partial<AlignReport> | undefined) => {
     if (alignReport === undefined) return [];
     // ... rest of logic
@@ -71,9 +73,9 @@ test('alignment chart data extraction with undefined report', () => {
   expect(result).toHaveLength(0);
 });
 
-test('alignment chart data extraction with empty notAlignedReasons', () => {
+test("alignment chart data extraction with empty notAlignedReasons", () => {
   const mockAlignReport: Partial<AlignReport> = {
-    type: 'alignerReport',
+    type: "alignerReport",
     totalReadsProcessed: 1000,
     aligned: 1000,
     notAligned: 0,
@@ -86,7 +88,9 @@ test('alignment chart data extraction with empty notAlignedReasons', () => {
     const aligned = alignReport.aligned || 0;
     const notAlignedReasons = alignReport.notAlignedReasons || {};
 
-    const result: Array<{ category: string; value: number }> = [{ category: 'Success', value: aligned }];
+    const result: Array<{ category: string; value: number }> = [
+      { category: "Success", value: aligned },
+    ];
 
     // Add not aligned reasons
     for (const [reason, count] of Object.entries(notAlignedReasons)) {
@@ -100,6 +104,6 @@ test('alignment chart data extraction with empty notAlignedReasons', () => {
 
   const result = extractAlignmentData(mockAlignReport);
   expect(result).toHaveLength(1); // Only Success category
-  expect(result[0].category).toBe('Success');
+  expect(result[0].category).toBe("Success");
   expect(result[0].value).toBe(1000);
 });
diff --git a/test/src/debugOutput.test.ts b/test/src/debugOutput.test.ts
index e2d6f86..4be443a 100644
--- a/test/src/debugOutput.test.ts
+++ b/test/src/debugOutput.test.ts
@@ -1,19 +1,19 @@
-import { test, expect } from 'vitest';
+import { test, expect } from "vitest";
 
 // Test the debug output functionality
-test('debug output structure', () => {
+test("debug output structure", () => {
   // Mock debug output structure
   const mockDebugOutput = {
     isComplete: true,
-    data: 'Repseqio library generation completed successfully',
+    data: "Repseqio library generation completed successfully",
   };
 
   expect(mockDebugOutput.isComplete).toBe(true);
-  expect(typeof mockDebugOutput.data).toBe('string');
-  expect(mockDebugOutput.data).toContain('Repseqio');
+  expect(typeof mockDebugOutput.data).toBe("string");
+  expect(mockDebugOutput.data).toContain("Repseqio");
 });
 
-test('debug output availability', () => {
+test("debug output availability", () => {
   // Test that debug output can be undefined initially
   const debugOutput = undefined;
   expect(debugOutput).toBeUndefined();
@@ -21,7 +21,7 @@ test('debug output availability', () => {
   // Test that debug output can be available later
   const debugOutputAvailable = {
     isComplete: true,
-    data: 'Library generation logs',
+    data: "Library generation logs",
   };
   expect(debugOutputAvailable).toBeDefined();
   expect(debugOutputAvailable.isComplete).toBe(true);
diff --git a/test/src/exportSpecs.test.ts b/test/src/exportSpecs.test.ts
index a1fa4d4..a2d8619 100644
--- a/test/src/exportSpecs.test.ts
+++ b/test/src/exportSpecs.test.ts
@@ -1,4 +1,4 @@
-import { test, expect, describe } from 'vitest';
+import { test, expect, describe } from "vitest";
 
 /**
  * These tests replicate the key logic from calculate-export-specs.lib.tengo
@@ -12,8 +12,8 @@ import { test, expect, describe } from 'vitest';
 
 // Mirrors formatAssemblingFeature in calculate-export-specs.lib.tengo
 function formatAssemblingFeature(fstr: string): string {
-  if (fstr === 'VDJRegion' || fstr === 'CDR3') return fstr;
-  const parts = fstr.split(':');
+  if (fstr === "VDJRegion" || fstr === "CDR3") return fstr;
+  const parts = fstr.split(":");
   if (parts.length === 1) return `{${parts[0]}Begin:${parts[0]}End}`;
   return `{${parts[0]}Begin:${parts[1]}End}`;
 }
@@ -22,9 +22,9 @@ function formatAssemblingFeature(fstr: string): string {
 // MiXCR has named aliases for ranges ending at FR4; other ranges use {XBegin:YEnd}
 function outputProductiveFeature(assemblingFeature: string): string {
   const productive = formatAssemblingFeature(assemblingFeature);
-  if (assemblingFeature !== 'VDJRegion' && assemblingFeature !== 'CDR3') {
-    const parts = assemblingFeature.split(':');
-    if (parts.length === 2 && parts[1] === 'FR4') {
+  if (assemblingFeature !== "VDJRegion" && assemblingFeature !== "CDR3") {
+    const parts = assemblingFeature.split(":");
+    if (parts.length === 2 && parts[1] === "FR4") {
       return `${parts[0]}_TO_FR4`;
     }
   }
@@ -33,17 +33,18 @@ function outputProductiveFeature(assemblingFeature: string): string {
 
 // Mirrors parseAssemblingFeature
 function parseAssemblingFeature(assemblingFeature: string) {
-  if (assemblingFeature === 'VDJRegion' || assemblingFeature === 'CDR3') {
+  if (assemblingFeature === "VDJRegion" || assemblingFeature === "CDR3") {
     return {
       imputed: [] as string[],
-      nonImputed: assemblingFeature === 'CDR3'
-        ? ['CDR3']
-        : ['CDR1', 'FR1', 'FR2', 'CDR2', 'FR3', 'CDR3', 'FR4', 'VDJRegion'],
+      nonImputed:
+        assemblingFeature === "CDR3"
+          ? ["CDR3"]
+          : ["CDR1", "FR1", "FR2", "CDR2", "FR3", "CDR3", "FR4", "VDJRegion"],
     };
   }
 
-  const features = ['FR1', 'CDR1', 'FR2', 'CDR2', 'FR3', 'CDR3', 'FR4'];
-  const [begin, end] = assemblingFeature.split(':');
+  const features = ["FR1", "CDR1", "FR2", "CDR2", "FR3", "CDR3", "FR4"];
+  const [begin, end] = assemblingFeature.split(":");
   const iBegin = features.indexOf(begin);
   const iEnd = features.indexOf(end);
 
@@ -54,10 +55,10 @@ function parseAssemblingFeature(assemblingFeature: string) {
   for (let i = iEnd + 1; i < features.length; i++) imputed.push(features[i]);
   for (let i = iBegin; i <= iEnd; i++) nonImputed.push(features[i]);
 
-  if (begin === 'FR1' && end === 'FR4') {
-    nonImputed.push('VDJRegion');
+  if (begin === "FR1" && end === "FR4") {
+    nonImputed.push("VDJRegion");
   } else {
-    imputed.push('VDJRegion');
+    imputed.push("VDJRegion");
   }
 
   return { imputed, nonImputed };
@@ -81,24 +82,24 @@ function computeClonotypeKeyAndExport(
 
   let clonotypeKeyColumns: string[];
 
-  if (assemblingFeature === 'CDR3') {
-    clonotypeKeyColumns = ['nSeqCDR3', 'bestVGene', 'bestJGene'];
+  if (assemblingFeature === "CDR3") {
+    clonotypeKeyColumns = ["nSeqCDR3", "bestVGene", "bestJGene"];
   } else {
     // VDJRegion is the assembling feature itself only when it's NOT in the imputed list
-    const vdjIsAssemblingFeature = imputedFeaturesMap['VDJRegion'] === undefined;
+    const vdjIsAssemblingFeature = imputedFeaturesMap["VDJRegion"] === undefined;
 
     if (vdjIsAssemblingFeature) {
       // VDJRegion IS the assembling feature, use it directly
-      clonotypeKeyColumns = ['nSeqVDJRegion', 'bestVGene', 'bestJGene'];
+      clonotypeKeyColumns = ["nSeqVDJRegion", "bestVGene", "bestJGene"];
     } else {
       // Range feature: always use assembling feature as key (not imputed VDJRegion)
       const keyColName = `nSeq${outputProductive}`;
-      clonotypeKeyColumns = [keyColName, 'bestVGene', 'bestJGene'];
+      clonotypeKeyColumns = [keyColName, "bestVGene", "bestJGene"];
     }
   }
 
-  const isRangeFeature = assemblingFeature !== 'CDR3' && assemblingFeature !== 'VDJRegion';
-  const vdjIsImputed = imputedFeaturesMap['VDJRegion'] === true;
+  const isRangeFeature = assemblingFeature !== "CDR3" && assemblingFeature !== "VDJRegion";
+  const vdjIsImputed = imputedFeaturesMap["VDJRegion"] === true;
   const needsAssemblingFeatureExport = isRangeFeature && vdjIsImputed;
 
   let assemblingFeatureColumn: string | undefined;
@@ -115,161 +116,161 @@ function computeClonotypeKeyAndExport(
 
 // --- Tests ---
 
-describe('formatAssemblingFeature', () => {
-  test('CDR3 returns CDR3', () => {
-    expect(formatAssemblingFeature('CDR3')).toBe('CDR3');
+describe("formatAssemblingFeature", () => {
+  test("CDR3 returns CDR3", () => {
+    expect(formatAssemblingFeature("CDR3")).toBe("CDR3");
   });
 
-  test('VDJRegion returns VDJRegion', () => {
-    expect(formatAssemblingFeature('VDJRegion')).toBe('VDJRegion');
+  test("VDJRegion returns VDJRegion", () => {
+    expect(formatAssemblingFeature("VDJRegion")).toBe("VDJRegion");
   });
 
-  test('range feature returns {XBegin:YEnd}', () => {
-    expect(formatAssemblingFeature('CDR1:FR4')).toBe('{CDR1Begin:FR4End}');
-    expect(formatAssemblingFeature('FR2:FR4')).toBe('{FR2Begin:FR4End}');
-    expect(formatAssemblingFeature('CDR1:CDR3')).toBe('{CDR1Begin:CDR3End}');
+  test("range feature returns {XBegin:YEnd}", () => {
+    expect(formatAssemblingFeature("CDR1:FR4")).toBe("{CDR1Begin:FR4End}");
+    expect(formatAssemblingFeature("FR2:FR4")).toBe("{FR2Begin:FR4End}");
+    expect(formatAssemblingFeature("CDR1:CDR3")).toBe("{CDR1Begin:CDR3End}");
   });
 });
 
-describe('outputProductiveFeature (MiXCR column naming)', () => {
-  test('CDR3 returns CDR3', () => {
-    expect(outputProductiveFeature('CDR3')).toBe('CDR3');
+describe("outputProductiveFeature (MiXCR column naming)", () => {
+  test("CDR3 returns CDR3", () => {
+    expect(outputProductiveFeature("CDR3")).toBe("CDR3");
   });
 
-  test('VDJRegion returns VDJRegion', () => {
-    expect(outputProductiveFeature('VDJRegion')).toBe('VDJRegion');
+  test("VDJRegion returns VDJRegion", () => {
+    expect(outputProductiveFeature("VDJRegion")).toBe("VDJRegion");
   });
 
-  test('ranges ending at FR4 use named aliases (X_TO_FR4)', () => {
-    expect(outputProductiveFeature('CDR1:FR4')).toBe('CDR1_TO_FR4');
-    expect(outputProductiveFeature('FR2:FR4')).toBe('FR2_TO_FR4');
-    expect(outputProductiveFeature('CDR2:FR4')).toBe('CDR2_TO_FR4');
-    expect(outputProductiveFeature('FR3:FR4')).toBe('FR3_TO_FR4');
+  test("ranges ending at FR4 use named aliases (X_TO_FR4)", () => {
+    expect(outputProductiveFeature("CDR1:FR4")).toBe("CDR1_TO_FR4");
+    expect(outputProductiveFeature("FR2:FR4")).toBe("FR2_TO_FR4");
+    expect(outputProductiveFeature("CDR2:FR4")).toBe("CDR2_TO_FR4");
+    expect(outputProductiveFeature("FR3:FR4")).toBe("FR3_TO_FR4");
   });
 
-  test('ranges NOT ending at FR4 use {XBegin:YEnd} format', () => {
-    expect(outputProductiveFeature('CDR1:CDR3')).toBe('{CDR1Begin:CDR3End}');
-    expect(outputProductiveFeature('FR2:CDR3')).toBe('{FR2Begin:CDR3End}');
-    expect(outputProductiveFeature('CDR1:FR3')).toBe('{CDR1Begin:FR3End}');
+  test("ranges NOT ending at FR4 use {XBegin:YEnd} format", () => {
+    expect(outputProductiveFeature("CDR1:CDR3")).toBe("{CDR1Begin:CDR3End}");
+    expect(outputProductiveFeature("FR2:CDR3")).toBe("{FR2Begin:CDR3End}");
+    expect(outputProductiveFeature("CDR1:FR3")).toBe("{CDR1Begin:FR3End}");
   });
 });
 
-describe('parseAssemblingFeature', () => {
-  test('CDR3 has no imputed features', () => {
-    const result = parseAssemblingFeature('CDR3');
+describe("parseAssemblingFeature", () => {
+  test("CDR3 has no imputed features", () => {
+    const result = parseAssemblingFeature("CDR3");
     expect(result.imputed).toEqual([]);
-    expect(result.nonImputed).toEqual(['CDR3']);
+    expect(result.nonImputed).toEqual(["CDR3"]);
   });
 
-  test('VDJRegion includes all features as nonImputed', () => {
-    const result = parseAssemblingFeature('VDJRegion');
+  test("VDJRegion includes all features as nonImputed", () => {
+    const result = parseAssemblingFeature("VDJRegion");
     expect(result.imputed).toEqual([]);
-    expect(result.nonImputed).toContain('VDJRegion');
+    expect(result.nonImputed).toContain("VDJRegion");
   });
 
-  test('CDR1:CDR3 puts VDJRegion and FR1,FR4 in imputed', () => {
-    const result = parseAssemblingFeature('CDR1:CDR3');
-    expect(result.imputed).toContain('VDJRegion');
-    expect(result.imputed).toContain('FR1');
-    expect(result.imputed).toContain('FR4');
-    expect(result.nonImputed).toContain('CDR1');
-    expect(result.nonImputed).toContain('CDR3');
+  test("CDR1:CDR3 puts VDJRegion and FR1,FR4 in imputed", () => {
+    const result = parseAssemblingFeature("CDR1:CDR3");
+    expect(result.imputed).toContain("VDJRegion");
+    expect(result.imputed).toContain("FR1");
+    expect(result.imputed).toContain("FR4");
+    expect(result.nonImputed).toContain("CDR1");
+    expect(result.nonImputed).toContain("CDR3");
   });
 
-  test('FR1:FR4 (full range) puts VDJRegion in nonImputed', () => {
-    const result = parseAssemblingFeature('FR1:FR4');
-    expect(result.nonImputed).toContain('VDJRegion');
+  test("FR1:FR4 (full range) puts VDJRegion in nonImputed", () => {
+    const result = parseAssemblingFeature("FR1:FR4");
+    expect(result.nonImputed).toContain("VDJRegion");
     expect(result.imputed).toHaveLength(0);
   });
 
-  test('FR2:FR4 puts FR1, CDR1 and VDJRegion in imputed', () => {
-    const result = parseAssemblingFeature('FR2:FR4');
-    expect(result.imputed).toContain('FR1');
-    expect(result.imputed).toContain('CDR1');
-    expect(result.imputed).toContain('VDJRegion');
+  test("FR2:FR4 puts FR1, CDR1 and VDJRegion in imputed", () => {
+    const result = parseAssemblingFeature("FR2:FR4");
+    expect(result.imputed).toContain("FR1");
+    expect(result.imputed).toContain("CDR1");
+    expect(result.imputed).toContain("VDJRegion");
   });
 });
 
-describe('clonotype key columns', () => {
-  test('CDR3: uses nSeqCDR3 as key', () => {
-    const r = computeClonotypeKeyAndExport('CDR3', false);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqCDR3');
+describe("clonotype key columns", () => {
+  test("CDR3: uses nSeqCDR3 as key", () => {
+    const r = computeClonotypeKeyAndExport("CDR3", false);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqCDR3");
     expect(r.needsAssemblingFeatureExport).toBe(false);
   });
 
-  test('VDJRegion: uses nSeqVDJRegion as key', () => {
-    const r = computeClonotypeKeyAndExport('VDJRegion', false);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqVDJRegion');
+  test("VDJRegion: uses nSeqVDJRegion as key", () => {
+    const r = computeClonotypeKeyAndExport("VDJRegion", false);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqVDJRegion");
     expect(r.needsAssemblingFeatureExport).toBe(false);
   });
 
-  test('FR1:FR4 without imputation: VDJRegion non-imputed, uses nSeqVDJRegion', () => {
-    const r = computeClonotypeKeyAndExport('FR1:FR4', false);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqVDJRegion');
+  test("FR1:FR4 without imputation: VDJRegion non-imputed, uses nSeqVDJRegion", () => {
+    const r = computeClonotypeKeyAndExport("FR1:FR4", false);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqVDJRegion");
     expect(r.needsAssemblingFeatureExport).toBe(false);
   });
 
   // Range ending at FR4 → MiXCR alias
-  test('CDR1:FR4 without imputation: uses nSeqCDR1_TO_FR4 (MiXCR alias)', () => {
-    const r = computeClonotypeKeyAndExport('CDR1:FR4', false);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqCDR1_TO_FR4');
+  test("CDR1:FR4 without imputation: uses nSeqCDR1_TO_FR4 (MiXCR alias)", () => {
+    const r = computeClonotypeKeyAndExport("CDR1:FR4", false);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqCDR1_TO_FR4");
     expect(r.needsAssemblingFeatureExport).toBe(true);
-    expect(r.assemblingFeatureColumn).toBe('nSeqCDR1_TO_FR4');
+    expect(r.assemblingFeatureColumn).toBe("nSeqCDR1_TO_FR4");
   });
 
-  test('FR2:FR4 without imputation: uses nSeqFR2_TO_FR4 (MiXCR alias)', () => {
-    const r = computeClonotypeKeyAndExport('FR2:FR4', false);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqFR2_TO_FR4');
+  test("FR2:FR4 without imputation: uses nSeqFR2_TO_FR4 (MiXCR alias)", () => {
+    const r = computeClonotypeKeyAndExport("FR2:FR4", false);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqFR2_TO_FR4");
     expect(r.needsAssemblingFeatureExport).toBe(true);
   });
 
   // Range NOT ending at FR4 → {XBegin:YEnd} format
-  test('CDR1:CDR3 without imputation: uses nSeq{CDR1Begin:CDR3End}', () => {
-    const r = computeClonotypeKeyAndExport('CDR1:CDR3', false);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeq{CDR1Begin:CDR3End}');
+  test("CDR1:CDR3 without imputation: uses nSeq{CDR1Begin:CDR3End}", () => {
+    const r = computeClonotypeKeyAndExport("CDR1:CDR3", false);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeq{CDR1Begin:CDR3End}");
     expect(r.needsAssemblingFeatureExport).toBe(true);
-    expect(r.assemblingFeatureColumn).toBe('nSeq{CDR1Begin:CDR3End}');
+    expect(r.assemblingFeatureColumn).toBe("nSeq{CDR1Begin:CDR3End}");
   });
 
   // With imputation → still uses assembling feature key (imputed VDJRegion is NOT unique per clone)
-  test('CDR1:CDR3 WITH imputation: still uses nSeq{CDR1Begin:CDR3End} (not imputed VDJRegion)', () => {
-    const r = computeClonotypeKeyAndExport('CDR1:CDR3', true);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeq{CDR1Begin:CDR3End}');
+  test("CDR1:CDR3 WITH imputation: still uses nSeq{CDR1Begin:CDR3End} (not imputed VDJRegion)", () => {
+    const r = computeClonotypeKeyAndExport("CDR1:CDR3", true);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeq{CDR1Begin:CDR3End}");
     expect(r.needsAssemblingFeatureExport).toBe(true);
   });
 
-  test('FR2:FR4 WITH imputation: still uses nSeqFR2_TO_FR4 (not imputed VDJRegion)', () => {
-    const r = computeClonotypeKeyAndExport('FR2:FR4', true);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqFR2_TO_FR4');
+  test("FR2:FR4 WITH imputation: still uses nSeqFR2_TO_FR4 (not imputed VDJRegion)", () => {
+    const r = computeClonotypeKeyAndExport("FR2:FR4", true);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqFR2_TO_FR4");
     expect(r.needsAssemblingFeatureExport).toBe(true);
   });
 
-  test('FR1:FR4 WITH imputation: VDJRegion non-imputed, uses nSeqVDJRegion', () => {
-    const r = computeClonotypeKeyAndExport('FR1:FR4', true);
-    expect(r.clonotypeKeyColumns[0]).toBe('nSeqVDJRegion');
+  test("FR1:FR4 WITH imputation: VDJRegion non-imputed, uses nSeqVDJRegion", () => {
+    const r = computeClonotypeKeyAndExport("FR1:FR4", true);
+    expect(r.clonotypeKeyColumns[0]).toBe("nSeqVDJRegion");
     expect(r.needsAssemblingFeatureExport).toBe(false);
   });
 });
 
-describe('isProductive column naming (must match MiXCR output)', () => {
-  test('CDR3: isProductiveCDR3', () => {
-    expect(`isProductive${outputProductiveFeature('CDR3')}`).toBe('isProductiveCDR3');
+describe("isProductive column naming (must match MiXCR output)", () => {
+  test("CDR3: isProductiveCDR3", () => {
+    expect(`isProductive${outputProductiveFeature("CDR3")}`).toBe("isProductiveCDR3");
   });
 
-  test('VDJRegion: isProductiveVDJRegion', () => {
-    expect(`isProductive${outputProductiveFeature('VDJRegion')}`).toBe('isProductiveVDJRegion');
+  test("VDJRegion: isProductiveVDJRegion", () => {
+    expect(`isProductive${outputProductiveFeature("VDJRegion")}`).toBe("isProductiveVDJRegion");
   });
 
-  test('FR2:FR4: isProductiveFR2_TO_FR4 (MiXCR named alias)', () => {
-    expect(`isProductive${outputProductiveFeature('FR2:FR4')}`).toBe('isProductiveFR2_TO_FR4');
+  test("FR2:FR4: isProductiveFR2_TO_FR4 (MiXCR named alias)", () => {
+    expect(`isProductive${outputProductiveFeature("FR2:FR4")}`).toBe("isProductiveFR2_TO_FR4");
   });
 
-  test('CDR1:FR4: isProductiveCDR1_TO_FR4 (MiXCR named alias)', () => {
-    expect(`isProductive${outputProductiveFeature('CDR1:FR4')}`).toBe('isProductiveCDR1_TO_FR4');
+  test("CDR1:FR4: isProductiveCDR1_TO_FR4 (MiXCR named alias)", () => {
+    expect(`isProductive${outputProductiveFeature("CDR1:FR4")}`).toBe("isProductiveCDR1_TO_FR4");
   });
 
-  test('CDR1:CDR3: isProductive{CDR1Begin:CDR3End} (no alias)', () => {
-    const col = `isProductive${outputProductiveFeature('CDR1:CDR3')}`;
-    expect(col).toBe('isProductive{CDR1Begin:CDR3End}');
+  test("CDR1:CDR3: isProductive{CDR1Begin:CDR3End} (no alias)", () => {
+    const col = `isProductive${outputProductiveFeature("CDR1:CDR3")}`;
+    expect(col).toBe("isProductive{CDR1Begin:CDR3End}");
   });
 });
diff --git a/test/src/wf.test.ts b/test/src/wf.test.ts
index 2c73a83..dedd705 100644
--- a/test/src/wf.test.ts
+++ b/test/src/wf.test.ts
@@ -1,21 +1,22 @@
-import type { BlockArgs, BlockOutputs, platforma } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
-import {
-  AlignReport,
-  Qc,
-} from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
-import { awaitStableState, blockTest } from '@platforma-sdk/test';
-import { blockSpec as samplesAndDataBlockSpec } from '@platforma-open/milaboratories.samples-and-data';
-import type { BlockArgs as SamplesAndDataBlockArgs } from '@platforma-open/milaboratories.samples-and-data.model';
-import { uniquePlId } from '@platforma-open/milaboratories.samples-and-data.model';
-import { blockSpec as myBlockSpec } from 'this-block';
-import type { InferBlockState } from '@platforma-sdk/model';
-import { wrapOutputs } from '@platforma-sdk/model';
+import type {
+  BlockArgs,
+  BlockOutputs,
+  platforma,
+} from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
+import { AlignReport, Qc } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
+import { awaitStableState, blockTest } from "@platforma-sdk/test";
+import { blockSpec as samplesAndDataBlockSpec } from "@platforma-open/milaboratories.samples-and-data";
+import type { BlockArgs as SamplesAndDataBlockArgs } from "@platforma-open/milaboratories.samples-and-data.model";
+import { uniquePlId } from "@platforma-open/milaboratories.samples-and-data.model";
+import { blockSpec as myBlockSpec } from "this-block";
+import type { InferBlockState } from "@platforma-sdk/model";
+import { wrapOutputs } from "@platforma-sdk/model";
 
 // prettier-ignore
 const referenceSequence = 'GAGGTGCAGCTCGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGACACTTTCCTGTGCAGCCTCTGGATTCACCTTTAACACCTATTGGATGACCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAATATAAATGAAGATGGAAGTGAAAACTACTATGCGGACTCTGTGAGGGGCCGATTCACCATTTTCAGAGACAACGCCAAGAACTCACTGTATCTGCAACTGAGCAGCCTGAGAGCCGAGGACACGTCTGTGTATTACTGTGCGAGATTCCGCGGGGGCCTTTGGGGCCAGGGAACCCTGGTCATTGTCTCCTCA';
 
-blockTest('empty inputs', { timeout: 20000 }, async ({ rawPrj: project, expect }) => {
-  const blockId = await project.addBlock('Block', myBlockSpec);
+blockTest("empty inputs", { timeout: 20000 }, async ({ rawPrj: project, expect }) => {
+  const blockId = await project.addBlock("Block", myBlockSpec);
   const stableState = (await awaitStableState(
     project.getBlockState(blockId),
     15000,
@@ -26,30 +27,30 @@ blockTest('empty inputs', { timeout: 20000 }, async ({ rawPrj: project, expect }
 });
 
 blockTest(
-  'simple project',
+  "simple project",
   { timeout: 300000 },
   async ({ rawPrj: project, ml, helpers, expect }) => {
-    const sndBlockId = await project.addBlock('Samples & Data', samplesAndDataBlockSpec);
-    const alignBlockId = await project.addBlock('MiXCR Amplicon Alignment', myBlockSpec);
+    const sndBlockId = await project.addBlock("Samples & Data", samplesAndDataBlockSpec);
+    const alignBlockId = await project.addBlock("MiXCR Amplicon Alignment", myBlockSpec);
 
     const sample1Id = uniquePlId();
     const dataset1Id = uniquePlId();
 
-    const r1Handle = await helpers.getLocalFileHandle('./assets/s1_R1.fastq.gz');
-    const r2Handle = await helpers.getLocalFileHandle('./assets/s1_R2.fastq.gz');
+    const r1Handle = await helpers.getLocalFileHandle("./assets/s1_R1.fastq.gz");
+    const r2Handle = await helpers.getLocalFileHandle("./assets/s1_R2.fastq.gz");
 
     await project.setBlockArgs(sndBlockId, {
       metadata: [],
       sampleIds: [sample1Id],
-      sampleLabelColumnLabel: 'Sample Name',
-      sampleLabels: { [sample1Id]: 'Sample 1' },
+      sampleLabelColumnLabel: "Sample Name",
+      sampleLabels: { [sample1Id]: "Sample 1" },
       datasets: [
         {
           id: dataset1Id,
-          label: 'Dataset 1',
+          label: "Dataset 1",
           content: {
-            type: 'Fastq',
-            readIndices: ['R1', 'R2'],
+            type: "Fastq",
+            readIndices: ["R1", "R2"],
             gzipped: true,
             data: {
               [sample1Id]: {
@@ -74,17 +75,16 @@ blockTest(
 
     // Wait for input options to propagate
     const alignBlockState = project.getBlockState(alignBlockId);
-    const alignStableState1 = (await awaitStableState(
-      alignBlockState,
-      25000,
-    )) as InferBlockState<typeof platforma>;
+    const alignStableState1 = (await awaitStableState(alignBlockState, 25000)) as InferBlockState<
+      typeof platforma
+    >;
 
     expect(alignStableState1.outputs).toMatchObject({
       inputOptions: {
         ok: true,
         value: [
           {
-            label: 'Dataset 1',
+            label: "Dataset 1",
           },
         ],
       },
@@ -98,12 +98,12 @@ blockTest(
 
     await project.setBlockArgs(alignBlockId, {
       datasetRef: alignOutputs1.inputOptions[0].ref,
-      chains: 'IGHeavy',
-      tagPattern: '',
+      chains: "IGHeavy",
+      tagPattern: "",
       vGenes: vGenesFasta,
       jGenes: jGenesFasta,
-      assemblingFeature: 'VDJRegion',
-      cloneClusteringMode: 'relaxed',
+      assemblingFeature: "VDJRegion",
+      cloneClusteringMode: "relaxed",
     } satisfies BlockArgs);
 
     const alignStableState2 = (await awaitStableState(
@@ -129,7 +129,7 @@ blockTest(
 
     const reportEntries = outputs3.reports.data;
     const alignJsonReportEntry = reportEntries.find(
-      (entry) => entry.key[1] === 'align' && entry.key[2] === 'json',
+      (entry) => entry.key[1] === "align" && entry.key[2] === "json",
     );
     expect(alignJsonReportEntry).toBeDefined();
 
@@ -141,7 +141,7 @@ blockTest(
               typeof ml.driverKit.blobDriver.getContent
             >[0],
           ),
-        ).toString('utf8'),
+        ).toString("utf8"),
       ),
     );
     expect(alignReport).toBeDefined();
@@ -157,7 +157,7 @@ blockTest(
           await ml.driverKit.blobDriver.getContent(
             qcEntry.value!.handle as Parameters<typeof ml.driverKit.blobDriver.getContent>[0],
           ),
-        ).toString('utf8'),
+        ).toString("utf8"),
       ),
     );
     expect(qc).toBeDefined();
@@ -165,30 +165,30 @@ blockTest(
 );
 
 blockTest(
-  'FR2:FR4 with imputation',
+  "FR2:FR4 with imputation",
   { timeout: 300000 },
   async ({ rawPrj: project, ml, helpers, expect }) => {
-    const sndBlockId = await project.addBlock('Samples & Data', samplesAndDataBlockSpec);
-    const alignBlockId = await project.addBlock('MiXCR Amplicon Alignment', myBlockSpec);
+    const sndBlockId = await project.addBlock("Samples & Data", samplesAndDataBlockSpec);
+    const alignBlockId = await project.addBlock("MiXCR Amplicon Alignment", myBlockSpec);
 
     const sample1Id = uniquePlId();
     const dataset1Id = uniquePlId();
 
-    const r1Handle = await helpers.getLocalFileHandle('./assets/s1_R1.fastq.gz');
-    const r2Handle = await helpers.getLocalFileHandle('./assets/s1_R2.fastq.gz');
+    const r1Handle = await helpers.getLocalFileHandle("./assets/s1_R1.fastq.gz");
+    const r2Handle = await helpers.getLocalFileHandle("./assets/s1_R2.fastq.gz");
 
     await project.setBlockArgs(sndBlockId, {
       metadata: [],
       sampleIds: [sample1Id],
-      sampleLabelColumnLabel: 'Sample Name',
-      sampleLabels: { [sample1Id]: 'Sample 1' },
+      sampleLabelColumnLabel: "Sample Name",
+      sampleLabels: { [sample1Id]: "Sample 1" },
       datasets: [
         {
           id: dataset1Id,
-          label: 'Dataset 1',
+          label: "Dataset 1",
           content: {
-            type: 'Fastq',
-            readIndices: ['R1', 'R2'],
+            type: "Fastq",
+            readIndices: ["R1", "R2"],
             gzipped: true,
             data: {
               [sample1Id]: {
@@ -218,13 +218,13 @@ blockTest(
 
     await project.setBlockArgs(alignBlockId, {
       datasetRef: alignOutputs1.inputOptions[0].ref,
-      chains: 'IGHeavy',
-      tagPattern: '',
+      chains: "IGHeavy",
+      tagPattern: "",
       vGenes: vGenesFasta,
       jGenes: jGenesFasta,
-      assemblingFeature: 'FR2:FR4',
+      assemblingFeature: "FR2:FR4",
       imputeGermline: true,
-      cloneClusteringMode: 'relaxed',
+      cloneClusteringMode: "relaxed",
     } satisfies BlockArgs);
 
     await project.runBlock(alignBlockId);
@@ -241,7 +241,7 @@ blockTest(
 
     const reportEntries = outputs3.reports.data;
     const alignJsonReportEntry = reportEntries.find(
-      (entry) => entry.key[1] === 'align' && entry.key[2] === 'json',
+      (entry) => entry.key[1] === "align" && entry.key[2] === "json",
     );
     expect(alignJsonReportEntry).toBeDefined();
 
@@ -253,7 +253,7 @@ blockTest(
               typeof ml.driverKit.blobDriver.getContent
             >[0],
           ),
-        ).toString('utf8'),
+        ).toString("utf8"),
       ),
     );
     expect(alignReport).toBeDefined();
@@ -265,30 +265,30 @@ blockTest(
 );
 
 blockTest(
-  'CDR1:CDR3 without imputation',
+  "CDR1:CDR3 without imputation",
   { timeout: 300000 },
   async ({ rawPrj: project, ml, helpers, expect }) => {
-    const sndBlockId = await project.addBlock('Samples & Data', samplesAndDataBlockSpec);
-    const alignBlockId = await project.addBlock('MiXCR Amplicon Alignment', myBlockSpec);
+    const sndBlockId = await project.addBlock("Samples & Data", samplesAndDataBlockSpec);
+    const alignBlockId = await project.addBlock("MiXCR Amplicon Alignment", myBlockSpec);
 
     const sample1Id = uniquePlId();
     const dataset1Id = uniquePlId();
 
-    const r1Handle = await helpers.getLocalFileHandle('./assets/s1_R1.fastq.gz');
-    const r2Handle = await helpers.getLocalFileHandle('./assets/s1_R2.fastq.gz');
+    const r1Handle = await helpers.getLocalFileHandle("./assets/s1_R1.fastq.gz");
+    const r2Handle = await helpers.getLocalFileHandle("./assets/s1_R2.fastq.gz");
 
     await project.setBlockArgs(sndBlockId, {
       metadata: [],
       sampleIds: [sample1Id],
-      sampleLabelColumnLabel: 'Sample Name',
-      sampleLabels: { [sample1Id]: 'Sample 1' },
+      sampleLabelColumnLabel: "Sample Name",
+      sampleLabels: { [sample1Id]: "Sample 1" },
       datasets: [
         {
           id: dataset1Id,
-          label: 'Dataset 1',
+          label: "Dataset 1",
           content: {
-            type: 'Fastq',
-            readIndices: ['R1', 'R2'],
+            type: "Fastq",
+            readIndices: ["R1", "R2"],
             gzipped: true,
             data: {
               [sample1Id]: {
@@ -318,13 +318,13 @@ blockTest(
 
     await project.setBlockArgs(alignBlockId, {
       datasetRef: alignOutputs1.inputOptions[0].ref,
-      chains: 'IGHeavy',
-      tagPattern: '',
+      chains: "IGHeavy",
+      tagPattern: "",
       vGenes: vGenesFasta,
       jGenes: jGenesFasta,
-      assemblingFeature: 'CDR1:CDR3',
+      assemblingFeature: "CDR1:CDR3",
       imputeGermline: false,
-      cloneClusteringMode: 'relaxed',
+      cloneClusteringMode: "relaxed",
     } satisfies BlockArgs);
 
     await project.runBlock(alignBlockId);
@@ -341,7 +341,7 @@ blockTest(
 
     const reportEntries = outputs3.reports.data;
     const alignJsonReportEntry = reportEntries.find(
-      (entry) => entry.key[1] === 'align' && entry.key[2] === 'json',
+      (entry) => entry.key[1] === "align" && entry.key[2] === "json",
     );
     expect(alignJsonReportEntry).toBeDefined();
 
@@ -353,7 +353,7 @@ blockTest(
               typeof ml.driverKit.blobDriver.getContent
             >[0],
           ),
-        ).toString('utf8'),
+        ).toString("utf8"),
       ),
     );
     expect(alignReport).toBeDefined();
diff --git a/test/test_config.json b/test/test_config.json
index e454791..b38f4ce 100644
--- a/test/test_config.json
+++ b/test/test_config.json
@@ -1,3 +1,3 @@
 {
   "address": "http://127.0.0.1:6345?tx-delay=5&force-sync=true"
-}
\ No newline at end of file
+}
diff --git a/test/vitest.config.mts b/test/vitest.config.mts
index 35a4fb9..0977962 100644
--- a/test/vitest.config.mts
+++ b/test/vitest.config.mts
@@ -1,9 +1,9 @@
-import { defineConfig } from 'vitest/config';
+import { defineConfig } from "vitest/config";
 
 export default defineConfig({
   test: {
     watch: false,
     testTimeout: 10000,
-    retry: 2
-  }
-});
\ No newline at end of file
+    retry: 2,
+  },
+});
diff --git a/turbo.json b/turbo.json
index 2400ba7..c6f0fab 100644
--- a/turbo.json
+++ b/turbo.json
@@ -2,11 +2,10 @@
   "$schema": "https://turbo.build/schema.json",
   "globalDependencies": ["tsconfig.json"],
   "tasks": {
-    "lint": {
-      "outputs": [],
-      "dependsOn": ["^build"]
+    "fmt": {
+      "outputs": []
     },
-    "type-check": {
+    "check": {
       "outputs": [],
       "dependsOn": ["^build"]
     },
@@ -14,7 +13,7 @@
       "inputs": ["$TURBO_DEFAULT$"],
       "env": ["PL_PKG_DEV"],
       "outputs": ["./dist/**", "./block-pack/**", "./pkg-*.tgz"],
-      "dependsOn": ["type-check", "lint", "^build"]
+      "dependsOn": ["check","^build"]
     },
     "do-pack": {
       "dependsOn": ["build"],
diff --git a/ui/.oxfmtrc.json b/ui/.oxfmtrc.json
new file mode 100644
index 0000000..ba9bb8f
--- /dev/null
+++ b/ui/.oxfmtrc.json
@@ -0,0 +1,3 @@
+{
+  "ignorePatterns": ["dist", "CHANGELOG.md"]
+}
diff --git a/ui/.oxlintrc.json b/ui/.oxlintrc.json
new file mode 100644
index 0000000..5cb5522
--- /dev/null
+++ b/ui/.oxlintrc.json
@@ -0,0 +1,3 @@
+{
+  "extends": ["node_modules/@milaboratories/ts-builder/dist/configs/oxlint-block-ui.json"]
+}
diff --git a/ui/eslint.config.mjs b/ui/eslint.config.mjs
deleted file mode 100644
index 30e2871..0000000
--- a/ui/eslint.config.mjs
+++ /dev/null
@@ -1,4 +0,0 @@
-import { ui } from '@platforma-sdk/eslint-config';
-
-/** @type {import('eslint').Linter.Config[]} */
-export default [...ui];
\ No newline at end of file
diff --git a/ui/index.html b/ui/index.html
index e37ab12..c604936 100644
--- a/ui/index.html
+++ b/ui/index.html
@@ -2,11 +2,11 @@
 <html lang="en">
   <head>
     <meta charset="UTF-8" />
-    <meta http-equiv="Content-Security-Policy" content="script-src 'self' blob:">
+    <meta http-equiv="Content-Security-Policy" content="script-src 'self' blob:" />
     <meta name="viewport" content="width=device-width, initial-scale=1.0" />
   </head>
   <body>
     <div id="app"></div>
     <script type="module" src="/src/main.ts"></script>
   </body>
-</html>
\ No newline at end of file
+</html>
diff --git a/ui/package.json b/ui/package.json
index 81884b3..7a7d251 100644
--- a/ui/package.json
+++ b/ui/package.json
@@ -3,31 +3,31 @@
   "version": "1.19.1",
   "type": "module",
   "scripts": {
+    "fmt": "ts-builder format",
+    "check": "ts-builder check --target block-ui",
     "dev": "ts-builder serve --target block-ui",
     "watch": "ts-builder build --target block-ui --watch",
     "build": "ts-builder build --target block-ui",
-    "type-check": "ts-builder type-check --target block-ui",
-    "lint": "eslint .",
     "do-pack": "rm -f *.tgz && pnpm pack && mv *.tgz package.tgz"
   },
   "dependencies": {
+    "@milaboratories/helpers": "catalog:",
     "@platforma-open/milaboratories.mixcr-amplicon-alignment.model": "workspace:*",
-    "@platforma-sdk/ui-vue": "catalog:",
     "@platforma-sdk/model": "catalog:",
-    "@milaboratories/helpers": "catalog:",
-    "vue": "catalog:",
+    "@platforma-sdk/ui-vue": "catalog:",
     "@vueuse/core": "catalog:",
+    "@zip.js/zip.js": "catalog:",
     "ag-grid-enterprise": "catalog:",
     "ag-grid-vue3": "catalog:",
-    "@zip.js/zip.js": "catalog:"
+    "vue": "catalog:"
   },
   "devDependencies": {
     "@milaboratories/ts-builder": "catalog:",
     "@milaboratories/ts-configs": "catalog:",
     "@platforma-sdk/eslint-config": "catalog:",
+    "@types/wicg-file-system-access": "catalog:",
     "eslint": "catalog:",
-    "vitest": "catalog:",
     "typescript": "catalog:",
-    "@types/wicg-file-system-access": "catalog:"
+    "vitest": "catalog:"
   }
 }
diff --git a/ui/src/ChunkedStreamReader.ts b/ui/src/ChunkedStreamReader.ts
index daa4af0..c0daa4e 100644
--- a/ui/src/ChunkedStreamReader.ts
+++ b/ui/src/ChunkedStreamReader.ts
@@ -1,6 +1,6 @@
-import type { RemoteBlobHandle } from '@platforma-sdk/model';
-import { getRawPlatformaInstance } from '@platforma-sdk/model';
-import { simpleRetry } from './simpleRetry.ts';
+import type { RemoteBlobHandle } from "@platforma-sdk/model";
+import { getRawPlatformaInstance } from "@platforma-sdk/model";
+import { simpleRetry } from "./simpleRetry.ts";
 
 export class ChunkedStreamReader {
   private readonly handle: RemoteBlobHandle;
@@ -10,10 +10,10 @@ export class ChunkedStreamReader {
 
   constructor(handle: RemoteBlobHandle, totalSize: number, chunkSize: number = 16 * 1024 * 1024) {
     if (totalSize < 0) {
-      throw new Error('Total size must be non-negative');
+      throw new Error("Total size must be non-negative");
     }
     if (chunkSize <= 0) {
-      throw new Error('Chunk size must be positive');
+      throw new Error("Chunk size must be positive");
     }
 
     this.handle = handle;
@@ -24,7 +24,10 @@ export class ChunkedStreamReader {
   createStream(): ReadableStream<Uint8Array> {
     return new ReadableStream({
       start: () => {
-        console.debug('[ChunkedStreamReader] start', { totalSize: this.totalSize, chunkSize: this.chunkSize });
+        console.debug("[ChunkedStreamReader] start", {
+          totalSize: this.totalSize,
+          chunkSize: this.chunkSize,
+        });
       },
 
       pull: async (controller) => {
@@ -36,29 +39,39 @@ export class ChunkedStreamReader {
 
           const endPosition = Math.min(this.currentPosition + this.chunkSize, this.totalSize);
 
-          const data = await simpleRetry(async () => getRawPlatformaInstance().blobDriver.getContent(
-            this.handle,
-            { from: this.currentPosition, to: endPosition },
-          ), {
-            maxAttempts: 3,
-            delay: 500,
-          });
+          const data = await simpleRetry(
+            async () =>
+              getRawPlatformaInstance().blobDriver.getContent(this.handle, {
+                from: this.currentPosition,
+                to: endPosition,
+              }),
+            {
+              maxAttempts: 3,
+              delay: 500,
+            },
+          );
 
           controller.enqueue(data);
 
           this.currentPosition = endPosition;
-          if (this.currentPosition % (64 * 1024 * 1024) === 0 || this.currentPosition >= this.totalSize) {
-            console.debug('[ChunkedStreamReader] progress', { current: this.currentPosition, total: this.totalSize });
+          if (
+            this.currentPosition % (64 * 1024 * 1024) === 0 ||
+            this.currentPosition >= this.totalSize
+          ) {
+            console.debug("[ChunkedStreamReader] progress", {
+              current: this.currentPosition,
+              total: this.totalSize,
+            });
           }
         } catch (error) {
-          console.error('[ChunkedStreamReader] error', error);
+          console.error("[ChunkedStreamReader] error", error);
           controller.error(error);
         }
       },
 
       cancel: (reason) => {
         this.currentPosition = 0;
-        console.debug('[ChunkedStreamReader] cancelled', reason);
+        console.debug("[ChunkedStreamReader] cancelled", reason);
       },
     });
   }
diff --git a/ui/src/ExportRawBtn/ExportRawBtn.vue b/ui/src/ExportRawBtn/ExportRawBtn.vue
index 2dd6d9c..c05052c 100644
--- a/ui/src/ExportRawBtn/ExportRawBtn.vue
+++ b/ui/src/ExportRawBtn/ExportRawBtn.vue
@@ -1,17 +1,12 @@
 <script setup lang="ts">
-import {
-  PlBtnGhost,
-  PlIcon16,
-  PlIcon24,
-  useClickOutside,
-} from '@platforma-sdk/ui-vue';
-import { uniqueId } from '@milaboratories/helpers';
-import { useApp } from '../app';
-import { ZipWriter, configure } from '@zip.js/zip.js';
-import { ChunkedStreamReader } from '../ChunkedStreamReader';
-import { reactive, computed, ref } from 'vue';
-import type { ExportItem, ExportsMap } from './types.ts';
-import Item from './Item.vue';
+import { PlBtnGhost, PlIcon16, PlIcon24, useClickOutside } from "@platforma-sdk/ui-vue";
+import { uniqueId } from "@milaboratories/helpers";
+import { useApp } from "../app";
+import { ZipWriter, configure } from "@zip.js/zip.js";
+import { ChunkedStreamReader } from "../ChunkedStreamReader";
+import { reactive, computed, ref } from "vue";
+import type { ExportItem, ExportsMap } from "./types.ts";
+import Item from "./Item.vue";
 
 const app = useApp();
 const DEBUG_DOWNLOAD = true as const;
@@ -21,7 +16,7 @@ configure({ useWebWorkers: false });
 
 const data = reactive({
   loading: false,
-  name: '',
+  name: "",
   exports: undefined as ExportsMap | undefined,
   showExports: false,
 });
@@ -39,7 +34,11 @@ const archive = computed<ExportItem>(() => {
     fileName: data.name,
     current: items.value.reduce((acc, item) => acc + item.current, 0),
     size: items.value.reduce((acc, item) => acc + item.size, 0),
-    status: items.value.some((item) => item.status === 'in-progress') ? 'in-progress' : items.value.every((item) => item.status === 'completed') ? 'completed' : 'pending',
+    status: items.value.some((item) => item.status === "in-progress")
+      ? "in-progress"
+      : items.value.every((item) => item.status === "completed")
+        ? "completed"
+        : "pending",
   };
 });
 
@@ -51,42 +50,46 @@ type ZipRequest = {
 };
 
 const exportRawTsvs = async () => {
-  if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] clicked; loading:', data.loading);
+  if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] clicked; loading:", data.loading);
   if (data.loading) {
     data.showExports = true;
     return;
   }
 
   if (!isReadyToExport.value) {
-    if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] not ready to export', {
-      hasRawTsvs: app.model.outputs.rawTsvs !== undefined,
-      hasSampleLabels: app.model.outputs.sampleLabels !== undefined,
-    });
+    if (DEBUG_DOWNLOAD)
+      console.debug("[ExportRaw] not ready to export", {
+        hasRawTsvs: app.model.outputs.rawTsvs !== undefined,
+        hasSampleLabels: app.model.outputs.sampleLabels !== undefined,
+      });
     return;
   }
 
   const pCols = app.model.outputs.rawTsvs;
   if (pCols === undefined) {
-    if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] pCols undefined');
+    if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] pCols undefined");
     return;
   }
 
   const sampleLabels = app.model.outputs.sampleLabels;
   if (sampleLabels === undefined) return undefined;
 
-  if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] preparing save dialog', {
-    pColsCount: pCols.length,
-    sampleLabelsCount: Object.keys(sampleLabels ?? {}).length,
-  });
+  if (DEBUG_DOWNLOAD)
+    console.debug("[ExportRaw] preparing save dialog", {
+      pColsCount: pCols.length,
+      sampleLabelsCount: Object.keys(sampleLabels ?? {}).length,
+    });
 
   const newHandle = await window.showSaveFilePicker({
-    types: [{
-      description: 'ZIP files',
-      accept: {
-        'application/zip': ['.zip'],
+    types: [
+      {
+        description: "ZIP files",
+        accept: {
+          "application/zip": [".zip"],
+        },
       },
-    }],
-    suggestedName: `${new Date().toISOString().split('T')[0]}_AmpliconAlignmentResultsRaw_${app.model.args.title ?? 'Untitled'}.zip`,
+    ],
+    suggestedName: `${new Date().toISOString().split("T")[0]}_AmpliconAlignmentResultsRaw_${app.model.args.title ?? "Untitled"}.zip`,
   });
 
   data.loading = true;
@@ -97,8 +100,12 @@ const exportRawTsvs = async () => {
   try {
     const startedAt = performance.now();
     const writableStream = await newHandle.createWritable();
-    const zip = new ZipWriter(writableStream, { keepOrder: true, zip64: true, bufferedWrite: false });
-    if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] ZIP writer created');
+    const zip = new ZipWriter(writableStream, {
+      keepOrder: true,
+      zip64: true,
+      bufferedWrite: false,
+    });
+    if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] ZIP writer created");
 
     try {
       const requests = [] as ZipRequest[];
@@ -109,15 +116,15 @@ const exportRawTsvs = async () => {
           const id = uniqueId();
           const { handle, size } = value!;
 
-          data.exports?.set(id, { fileName, current: 0, size, status: 'pending' });
+          data.exports?.set(id, { fileName, current: 0, size, status: "pending" });
 
           // Create a chunked stream reader for efficient streaming
           requests.push({ id, fileName, size, stream: new ChunkedStreamReader(handle, size) });
-          if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] queued file', { id, fileName, size });
+          if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] queued file", { id, fileName, size });
         }
       }
 
-      if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] total files queued', requests.length);
+      if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] total files queued", requests.length);
 
       const lastPct = new Map<string, number>();
       for (const request of requests) {
@@ -128,12 +135,12 @@ const exportRawTsvs = async () => {
             data.exports?.set(id, { ...it, ...partial });
           }
         };
-        if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] zip.add start', { id, fileName, size });
+        if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] zip.add start", { id, fileName, size });
         await zip.add(fileName, stream.createStream(), {
           bufferedWrite: false,
           onstart: () => {
-            update({ status: 'in-progress' });
-            if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] onstart', { id, fileName });
+            update({ status: "in-progress" });
+            if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] onstart", { id, fileName });
             return undefined;
           },
           onprogress: (current) => {
@@ -143,25 +150,26 @@ const exportRawTsvs = async () => {
               const last = lastPct.get(id) ?? -1;
               if (pct !== last && pct % 10 === 0) {
                 lastPct.set(id, pct);
-                console.debug('[ExportRaw] onprogress', { id, fileName, current, size, pct });
+                console.debug("[ExportRaw] onprogress", { id, fileName, current, size, pct });
               }
             }
             return undefined;
           },
           onend() {
-            update({ current: size, status: 'completed' });
-            if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] onend', { id, fileName, size });
+            update({ current: size, status: "completed" });
+            if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] onend", { id, fileName, size });
             return undefined;
           },
         });
       }
     } finally {
       await zip.close();
-      if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] ZIP closed', { ms: Math.round(performance.now() - startedAt) });
+      if (DEBUG_DOWNLOAD)
+        console.debug("[ExportRaw] ZIP closed", { ms: Math.round(performance.now() - startedAt) });
     }
   } finally {
     data.loading = false;
-    if (DEBUG_DOWNLOAD) console.debug('[ExportRaw] export finished');
+    if (DEBUG_DOWNLOAD) console.debug("[ExportRaw] export finished");
   }
 };
 
@@ -175,7 +183,8 @@ useClickOutside([progressesRef], () => {
 <template>
   <PlBtnGhost
     :disabled="!isReadyToExport"
-    :loading="data.loading" :class="{ [$style['has-exports']]: data.exports }"
+    :loading="data.loading"
+    :class="{ [$style['has-exports']]: data.exports }"
     @click.stop="exportRawTsvs"
   >
     Export Raw Results
diff --git a/ui/src/ExportRawBtn/Item.vue b/ui/src/ExportRawBtn/Item.vue
index 1f7e9ae..3c578e0 100644
--- a/ui/src/ExportRawBtn/Item.vue
+++ b/ui/src/ExportRawBtn/Item.vue
@@ -1,6 +1,6 @@
 <script setup lang="ts">
-import type { ExportItem } from './types.ts';
-import { prettyBytes } from '@milaboratories/helpers';
+import type { ExportItem } from "./types.ts";
+import { prettyBytes } from "@milaboratories/helpers";
 
 defineProps<{
   item: ExportItem;
@@ -8,9 +8,7 @@ defineProps<{
 </script>
 
 <template>
-  <div
-    :class="$style.item"
-  >
+  <div :class="$style.item">
     <div :class="$style.name">{{ item.fileName }}</div>
     <div v-if="item.status === 'in-progress'" :class="$style.details">
       <span>{{ prettyBytes(item.current, {}) }}</span>
@@ -20,9 +18,7 @@ defineProps<{
     <div v-else-if="item.status === 'completed'" :class="$style.details">
       Done <span>{{ prettyBytes(item.size, {}) }}</span>
     </div>
-    <div v-else :class="$style.details">
-      Pending
-    </div>
+    <div v-else :class="$style.details">Pending</div>
   </div>
 </template>
 
diff --git a/ui/src/ExportRawBtn/index.ts b/ui/src/ExportRawBtn/index.ts
index 375b8f9..3583e3d 100644
--- a/ui/src/ExportRawBtn/index.ts
+++ b/ui/src/ExportRawBtn/index.ts
@@ -1 +1 @@
-export { default as ExportRawBtn } from './ExportRawBtn.vue';
+export { default as ExportRawBtn } from "./ExportRawBtn.vue";
diff --git a/ui/src/ExportRawBtn/types.ts b/ui/src/ExportRawBtn/types.ts
index d810751..c87122d 100644
--- a/ui/src/ExportRawBtn/types.ts
+++ b/ui/src/ExportRawBtn/types.ts
@@ -2,7 +2,7 @@ export type ExportItem = {
   fileName: string;
   current: number;
   size: number;
-  status: 'pending' | 'in-progress' | 'completed';
+  status: "pending" | "in-progress" | "completed";
 };
 
 export type ExportsMap = Map<string, ExportItem>;
diff --git a/ui/src/app.ts b/ui/src/app.ts
index e3eacc0..45d1473 100644
--- a/ui/src/app.ts
+++ b/ui/src/app.ts
@@ -1,14 +1,14 @@
-import { platforma } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
-import { defineApp } from '@platforma-sdk/ui-vue';
-import MainPage from './pages/MainPage.vue';
-import QcReportTablePage from './pages/QcReportTablePage.vue';
-import { watch } from 'vue';
+import { platforma } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
+import { defineApp } from "@platforma-sdk/ui-vue";
+import MainPage from "./pages/MainPage.vue";
+import QcReportTablePage from "./pages/QcReportTablePage.vue";
+import { watch } from "vue";
 
 export const sdkPlugin = defineApp(platforma, () => {
   return {
     routes: {
-      '/': () => MainPage,
-      '/qc-report-table': () => QcReportTablePage,
+      "/": () => MainPage,
+      "/qc-report-table": () => QcReportTablePage,
     },
   };
 });
@@ -19,7 +19,7 @@ export const useApp = sdkPlugin.useApp;
 const unwatch = watch(sdkPlugin, ({ loaded }) => {
   if (!loaded) return;
   const app = useApp();
-  app.model.args.customBlockLabel ??= '';
-  app.model.args.defaultBlockLabel ??= 'Select Clonotype Definition';
+  app.model.args.customBlockLabel ??= "";
+  app.model.args.defaultBlockLabel ??= "Select Clonotype Definition";
   unwatch();
 });
diff --git a/ui/src/charts/AlignmentsChart.vue b/ui/src/charts/AlignmentsChart.vue
index 915fabc..b82aa49 100644
--- a/ui/src/charts/AlignmentsChart.vue
+++ b/ui/src/charts/AlignmentsChart.vue
@@ -1,8 +1,8 @@
 <script setup lang="ts">
-import { PlChartStackedBar } from '@platforma-sdk/ui-vue';
-import { computed } from 'vue';
-import { useAlignmentChartSettings } from './alignmentChartSettings';
-import type { AlignReport } from '../results';
+import { PlChartStackedBar } from "@platforma-sdk/ui-vue";
+import { computed } from "vue";
+import { useAlignmentChartSettings } from "./alignmentChartSettings";
+import type { AlignReport } from "../results";
 
 const props = defineProps<{
   alignReport?: AlignReport;
diff --git a/ui/src/charts/alignmentChartSettings.ts b/ui/src/charts/alignmentChartSettings.ts
index b65986e..444095c 100644
--- a/ui/src/charts/alignmentChartSettings.ts
+++ b/ui/src/charts/alignmentChartSettings.ts
@@ -1,12 +1,10 @@
-import type { AlignReport } from '../results';
-import type { Color } from '@platforma-sdk/ui-vue';
-import { Gradient } from '@platforma-sdk/ui-vue';
-import type { Ref } from 'vue';
-import { computed, unref } from 'vue';
+import type { AlignReport } from "../results";
+import type { Color } from "@platforma-sdk/ui-vue";
+import { Gradient } from "@platforma-sdk/ui-vue";
+import type { Ref } from "vue";
+import { computed, unref } from "vue";
 
-export function getAlignmentChartSettings(
-  alignReport: AlignReport | undefined,
-) {
+export function getAlignmentChartSettings(alignReport: AlignReport | undefined) {
   const data = (() => {
     if (alignReport === undefined) return [];
 
@@ -14,7 +12,7 @@ export function getAlignmentChartSettings(
     const aligned = alignReport.aligned || 0;
     const notAlignedReasons = alignReport.notAlignedReasons || {};
 
-    const result = [{ category: 'Success', value: aligned }];
+    const result = [{ category: "Success", value: aligned }];
 
     // Add not aligned reasons
     for (const [reason, count] of Object.entries(notAlignedReasons)) {
@@ -28,8 +26,8 @@ export function getAlignmentChartSettings(
 
   const total = data.reduce((x, y) => x + y.value, 0);
 
-  const viridis = Gradient('viridis');
-  const magma = Gradient('magma');
+  const viridis = Gradient("viridis");
+  const magma = Gradient("magma");
 
   const categoryColors = {
     Success: viridis.getNthOf(2, 5),
@@ -45,20 +43,20 @@ export function getAlignmentChartSettings(
   } as Record<string, Color>;
 
   const categoryLabels: Record<string, string> = {
-    Success: 'Successful Alignments',
-    NoHits: 'No Gene Hits',
-    NoCDR3Parts: 'No CDR3 Parts',
-    NoVHits: 'No V Gene Hits',
-    NoJHits: 'No J Gene Hits',
-    VAndJOnDifferentTargets: 'V and J on Different Targets',
-    LowTotalScore: 'Low Total Score',
-    NoBarcode: 'No Barcode',
-    SampleNotMatched: 'Sample Not Matched',
-    FailedAfterAOverlap: 'Failed After A Overlap',
+    Success: "Successful Alignments",
+    NoHits: "No Gene Hits",
+    NoCDR3Parts: "No CDR3 Parts",
+    NoVHits: "No V Gene Hits",
+    NoJHits: "No J Gene Hits",
+    VAndJOnDifferentTargets: "V and J on Different Targets",
+    LowTotalScore: "Low Total Score",
+    NoBarcode: "No Barcode",
+    SampleNotMatched: "Sample Not Matched",
+    FailedAfterAOverlap: "Failed After A Overlap",
   };
 
   return {
-    title: 'Alignments',
+    title: "Alignments",
     data: data.map(({ category, value }) => {
       const color = categoryColors[category] || viridis.getNthOf(1, 5);
       return {
@@ -67,16 +65,14 @@ export function getAlignmentChartSettings(
         color,
         description: [
           categoryLabels[category] || category,
-          'Fraction:' + Math.round((value * 100) / total) + '%',
-        ].join('\n'),
+          "Fraction:" + Math.round((value * 100) / total) + "%",
+        ].join("\n"),
       };
     }),
   };
 }
 
-export function useAlignmentChartSettings(
-  alignReportRef: Ref<AlignReport | undefined>,
-) {
+export function useAlignmentChartSettings(alignReportRef: Ref<AlignReport | undefined>) {
   return computed(() => {
     const alignReport = unref(alignReportRef);
     return getAlignmentChartSettings(alignReport);
diff --git a/ui/src/main.ts b/ui/src/main.ts
index 09dc2db..899885c 100644
--- a/ui/src/main.ts
+++ b/ui/src/main.ts
@@ -1,5 +1,5 @@
-import { BlockLayout } from '@platforma-sdk/ui-vue';
-import { createApp } from 'vue';
-import { sdkPlugin } from './app';
+import { BlockLayout } from "@platforma-sdk/ui-vue";
+import { createApp } from "vue";
+import { sdkPlugin } from "./app";
 
-createApp(BlockLayout).use(sdkPlugin).mount('#app');
+createApp(BlockLayout).use(sdkPlugin).mount("#app");
diff --git a/ui/src/pages/BuildLibraryPanel.vue b/ui/src/pages/BuildLibraryPanel.vue
index e4822ce..5d9d1cf 100644
--- a/ui/src/pages/BuildLibraryPanel.vue
+++ b/ui/src/pages/BuildLibraryPanel.vue
@@ -1,41 +1,50 @@
 <script setup lang="ts">
-import type { ImportFileHandle, LocalImportFileHandle } from '@platforma-sdk/model';
-import { getRawPlatformaInstance } from '@platforma-sdk/model';
-import type { LibraryEntryDefinition } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
-import {
-  PlFileInput,
-  PlTextField,
-  ReactiveFileContent,
-} from '@platforma-sdk/ui-vue';
-import { computed, reactive, ref, watch } from 'vue';
-import { useApp } from '../app';
-import { parseFasta } from '../utils/parseFasta';
+import type { ImportFileHandle, LocalImportFileHandle } from "@platforma-sdk/model";
+import { getRawPlatformaInstance } from "@platforma-sdk/model";
+import type { LibraryEntryDefinition } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
+import { PlFileInput, PlTextField, ReactiveFileContent } from "@platforma-sdk/ui-vue";
+import { computed, reactive, ref, watch } from "vue";
+import { useApp } from "../app";
+import { parseFasta } from "../utils/parseFasta";
 import {
   getVRegions,
   getJRegions,
   recomposeVGene,
   recomposeJGene,
   translateDNA,
-} from '../utils/buildLibrary';
-import { parseRepseqioLibrary } from '../utils/parseRepseqioLibrary';
+} from "../utils/buildLibrary";
+import { parseRepseqioLibrary } from "../utils/parseRepseqioLibrary";
 
 const app = useApp();
 
 // Entry definitions bound to model args
 const libraryEntries = computed({
   get: () => app.model.args.libraryEntries ?? [],
-  set: (v: LibraryEntryDefinition[]) => { app.model.args.libraryEntries = v.length > 0 ? v : undefined; },
+  set: (v: LibraryEntryDefinition[]) => {
+    app.model.args.libraryEntries = v.length > 0 ? v : undefined;
+  },
 });
 
 function addLibraryEntry() {
   const newIndex = libraryEntries.value.length;
-  libraryEntries.value = [...libraryEntries.value, {
-    name: '',
-    vSequence: '',
-    jSequence: '',
-    vAnchorPoints: { fr1Begin: 0, cdr1Begin: 0, fr2Begin: 0, cdr2Begin: 0, fr3Begin: 0, cdr3Begin: 0, vEnd: 0 },
-    jAnchorPoints: { jBegin: 0, fr4Begin: 0, fr4End: 0 },
-  }];
+  libraryEntries.value = [
+    ...libraryEntries.value,
+    {
+      name: "",
+      vSequence: "",
+      jSequence: "",
+      vAnchorPoints: {
+        fr1Begin: 0,
+        cdr1Begin: 0,
+        fr2Begin: 0,
+        cdr2Begin: 0,
+        fr3Begin: 0,
+        cdr3Begin: 0,
+        vEnd: 0,
+      },
+      jAnchorPoints: { jBegin: 0, fr4Begin: 0, fr4End: 0 },
+    },
+  ];
   expandedEntries.add(newIndex);
 }
 
@@ -60,8 +69,8 @@ function toggleEntry(index: number) {
 }
 
 // Region editing
-type VRegionKey = 'fr1' | 'cdr1' | 'fr2' | 'cdr2' | 'fr3' | 'vPartCdr3';
-type JRegionKey = 'jPartCdr3' | 'fr4';
+type VRegionKey = "fr1" | "cdr1" | "fr2" | "cdr2" | "fr3" | "vPartCdr3";
+type JRegionKey = "jPartCdr3" | "fr4";
 
 function updateVRegion(entry: LibraryEntryDefinition, region: VRegionKey, value: string) {
   const regions = getVRegions(entry);
@@ -84,7 +93,8 @@ const validNtPattern = /^[ACGTNRYSWKMBDHV]*$/i;
 
 function regionCharError(seq: string): string | undefined {
   if (!seq) return undefined;
-  if (!validNtPattern.test(seq)) return 'Only nucleotide (ACGT) and wildcard (N, IUPAC) symbols allowed';
+  if (!validNtPattern.test(seq))
+    return "Only nucleotide (ACGT) and wildcard (N, IUPAC) symbols allowed";
   return undefined;
 }
 
@@ -97,28 +107,39 @@ function regionLengthError(seq: string): string | undefined {
 function cdr3LengthError(vPartCdr3: string, jPartCdr3: string): string | undefined {
   const combined = (vPartCdr3?.length ?? 0) + (jPartCdr3?.length ?? 0);
   if (combined === 0) return undefined;
-  if (combined % 3 !== 0) return `Combined CDR3 length must be a multiple of 3 (current: ${combined})`;
+  if (combined % 3 !== 0)
+    return `Combined CDR3 length must be a multiple of 3 (current: ${combined})`;
   return undefined;
 }
 
-function getRegionError(entry: LibraryEntryDefinition, region: VRegionKey | JRegionKey): string | undefined {
+function getRegionError(
+  entry: LibraryEntryDefinition,
+  region: VRegionKey | JRegionKey,
+): string | undefined {
   const vRegions = getVRegions(entry);
   const jRegions = getJRegions(entry);
 
-  const seq = region in vRegions
-    ? vRegions[region as VRegionKey]
-    : jRegions[region as JRegionKey];
+  const seq = region in vRegions ? vRegions[region as VRegionKey] : jRegions[region as JRegionKey];
 
   const charErr = regionCharError(seq);
   if (charErr) return charErr;
 
-  if (region === 'vPartCdr3' || region === 'jPartCdr3') {
+  if (region === "vPartCdr3" || region === "jPartCdr3") {
     return cdr3LengthError(vRegions.vPartCdr3, jRegions.jPartCdr3);
   }
   return regionLengthError(seq);
 }
 
-const allRegions: (VRegionKey | JRegionKey)[] = ['fr1', 'cdr1', 'fr2', 'cdr2', 'fr3', 'vPartCdr3', 'jPartCdr3', 'fr4'];
+const allRegions: (VRegionKey | JRegionKey)[] = [
+  "fr1",
+  "cdr1",
+  "fr2",
+  "cdr2",
+  "fr3",
+  "vPartCdr3",
+  "jPartCdr3",
+  "fr4",
+];
 
 function getEntryError(entry: LibraryEntryDefinition): string | undefined {
   for (const region of allRegions) {
@@ -130,8 +151,8 @@ function getEntryError(entry: LibraryEntryDefinition): string | undefined {
 
 // FASTA upload → prerun sync
 const buildLibraryFastaError = ref<string | undefined>();
-type PrerunWaitState = 'idle' | 'waitForClear' | 'waitForResult';
-const prerunWait = ref<PrerunWaitState>('idle');
+type PrerunWaitState = "idle" | "waitForClear" | "waitForResult";
+const prerunWait = ref<PrerunWaitState>("idle");
 
 async function onBuildLibraryFastaUpload(file: ImportFileHandle | undefined) {
   app.model.ui.buildLibraryFastaFile = file;
@@ -140,47 +161,49 @@ async function onBuildLibraryFastaUpload(file: ImportFileHandle | undefined) {
     buildLibraryFastaError.value = undefined;
     app.model.args.buildLibraryVGenes = undefined;
     app.model.args.buildLibraryJGenes = undefined;
-    prerunWait.value = 'idle';
+    prerunWait.value = "idle";
     libraryEntries.value = [];
     return;
   }
 
   try {
-    const data = await getRawPlatformaInstance().lsDriver.getLocalFileContent(file as LocalImportFileHandle);
+    const data = await getRawPlatformaInstance().lsDriver.getLocalFileContent(
+      file as LocalImportFileHandle,
+    );
     const content = new TextDecoder().decode(data);
     const result = parseFasta(content, undefined, true);
 
     if (result.isValid) {
       buildLibraryFastaError.value = undefined;
       libraryEntries.value = [];
-      prerunWait.value = app.model.outputs.prerunLibrary ? 'waitForClear' : 'waitForResult';
+      prerunWait.value = app.model.outputs.prerunLibrary ? "waitForClear" : "waitForResult";
       app.model.args.buildLibraryVGenes = result.vGenes;
       app.model.args.buildLibraryJGenes = result.jGenes;
     } else {
       buildLibraryFastaError.value = result.error;
       app.model.args.buildLibraryVGenes = undefined;
       app.model.args.buildLibraryJGenes = undefined;
-      prerunWait.value = 'idle';
+      prerunWait.value = "idle";
       libraryEntries.value = [];
     }
   } catch (e) {
-    buildLibraryFastaError.value = `Failed to read file: ${e instanceof Error ? e.message : 'Unknown error'}`;
+    buildLibraryFastaError.value = `Failed to read file: ${e instanceof Error ? e.message : "Unknown error"}`;
     app.model.args.buildLibraryVGenes = undefined;
     app.model.args.buildLibraryJGenes = undefined;
-    prerunWait.value = 'idle';
+    prerunWait.value = "idle";
     libraryEntries.value = [];
   }
 }
 
 const reactiveFileContent = ReactiveFileContent.useGlobal();
-const prerunLibraryLoading = computed(() => prerunWait.value !== 'idle');
+const prerunLibraryLoading = computed(() => prerunWait.value !== "idle");
 
 // Phase 1: waitForClear → waitForResult when output goes undefined
 watch(
   () => app.model.outputs.prerunLibrary,
   (val) => {
-    if (prerunWait.value === 'waitForClear' && !val) {
-      prerunWait.value = 'waitForResult';
+    if (prerunWait.value === "waitForClear" && !val) {
+      prerunWait.value = "waitForResult";
     }
   },
 );
@@ -188,19 +211,19 @@ watch(
 // Phase 2: waitForResult → idle when content arrives
 watch(
   () => {
-    if (prerunWait.value !== 'waitForResult') return undefined;
+    if (prerunWait.value !== "waitForResult") return undefined;
     const blobHandleAndSize = app.model.outputs.prerunLibrary;
     if (!blobHandleAndSize) return undefined;
     return reactiveFileContent.getContentString(blobHandleAndSize.handle)?.value;
   },
   (content) => {
-    if (!content || prerunWait.value !== 'waitForResult') return;
+    if (!content || prerunWait.value !== "waitForResult") return;
     const entries = parseRepseqioLibrary(content);
     if (entries.length > 0) {
       libraryEntries.value = entries;
       expandedEntries.clear();
     }
-    prerunWait.value = 'idle';
+    prerunWait.value = "idle";
   },
 );
 </script>
@@ -215,16 +238,20 @@ watch(
     @update:model-value="onBuildLibraryFastaUpload"
   >
     <template #tooltip>
-      Upload a FASTA file containing full VDJ nucleotide sequences. Anchor points will be inferred automatically using repseqio and entries will be populated below.
+      Upload a FASTA file containing full VDJ nucleotide sequences. Anchor points will be inferred
+      automatically using repseqio and entries will be populated below.
     </template>
   </PlFileInput>
-  <div v-if="prerunLibraryLoading" class="prerun-loading">
-    Inferring anchor points...
-  </div>
+  <div v-if="prerunLibraryLoading" class="prerun-loading">Inferring anchor points...</div>
   <div v-for="(entry, index) in libraryEntries" :key="index" class="library-entry">
     <div class="entry-header" @click="toggleEntry(index)">
-      <span class="entry-chevron">{{ expandedEntries.has(index) ? '\u25BC' : '\u25B6' }}</span>
-      <span :class="getEntryError(entry) ? 'entry-header-title' : 'entry-header-title entry-header-title-fill'">{{ entry.name || `Entry ${index + 1}` }}</span>
+      <span class="entry-chevron">{{ expandedEntries.has(index) ? "\u25BC" : "\u25B6" }}</span>
+      <span
+        :class="
+          getEntryError(entry) ? 'entry-header-title' : 'entry-header-title entry-header-title-fill'
+        "
+        >{{ entry.name || `Entry ${index + 1}` }}</span
+      >
       <span v-if="getEntryError(entry)" class="entry-header-error">{{ getEntryError(entry) }}</span>
       <button class="entry-close-btn" @click.stop="removeLibraryEntry(index)">&times;</button>
     </div>
@@ -233,48 +260,100 @@ watch(
         <PlTextField v-model="entry.name" label="Entry name" />
       </div>
 
-      <div class="gene-section-title">V gene ({{ entry.name ? entry.name + '_Vgene' : '...' }})</div>
+      <div class="gene-section-title">
+        V gene ({{ entry.name ? entry.name + "_Vgene" : "..." }})
+      </div>
       <div class="region-row">
         <div class="region-label">FR1</div>
-        <PlTextField class="region-nt" :model-value="getVRegions(entry).fr1" :error="getRegionError(entry, 'fr1')" @update:model-value="(v: string) => updateVRegion(entry, 'fr1', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getVRegions(entry).fr1) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getVRegions(entry).fr1"
+          :error="getRegionError(entry, 'fr1')"
+          @update:model-value="(v: string) => updateVRegion(entry, 'fr1', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getVRegions(entry).fr1) || "-" }}</div>
       </div>
       <div class="region-row">
         <div class="region-label">CDR1</div>
-        <PlTextField class="region-nt" :model-value="getVRegions(entry).cdr1" :error="getRegionError(entry, 'cdr1')" @update:model-value="(v: string) => updateVRegion(entry, 'cdr1', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getVRegions(entry).cdr1) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getVRegions(entry).cdr1"
+          :error="getRegionError(entry, 'cdr1')"
+          @update:model-value="(v: string) => updateVRegion(entry, 'cdr1', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getVRegions(entry).cdr1) || "-" }}</div>
       </div>
       <div class="region-row">
         <div class="region-label">FR2</div>
-        <PlTextField class="region-nt" :model-value="getVRegions(entry).fr2" :error="getRegionError(entry, 'fr2')" @update:model-value="(v: string) => updateVRegion(entry, 'fr2', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getVRegions(entry).fr2) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getVRegions(entry).fr2"
+          :error="getRegionError(entry, 'fr2')"
+          @update:model-value="(v: string) => updateVRegion(entry, 'fr2', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getVRegions(entry).fr2) || "-" }}</div>
       </div>
       <div class="region-row">
         <div class="region-label">CDR2</div>
-        <PlTextField class="region-nt" :model-value="getVRegions(entry).cdr2" :error="getRegionError(entry, 'cdr2')" @update:model-value="(v: string) => updateVRegion(entry, 'cdr2', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getVRegions(entry).cdr2) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getVRegions(entry).cdr2"
+          :error="getRegionError(entry, 'cdr2')"
+          @update:model-value="(v: string) => updateVRegion(entry, 'cdr2', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getVRegions(entry).cdr2) || "-" }}</div>
       </div>
       <div class="region-row">
         <div class="region-label">FR3</div>
-        <PlTextField class="region-nt" :model-value="getVRegions(entry).fr3" :error="getRegionError(entry, 'fr3')" @update:model-value="(v: string) => updateVRegion(entry, 'fr3', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getVRegions(entry).fr3) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getVRegions(entry).fr3"
+          :error="getRegionError(entry, 'fr3')"
+          @update:model-value="(v: string) => updateVRegion(entry, 'fr3', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getVRegions(entry).fr3) || "-" }}</div>
       </div>
       <div class="region-row">
         <div class="region-label">V part CDR3</div>
-        <PlTextField class="region-nt" :model-value="getVRegions(entry).vPartCdr3" :error="getRegionError(entry, 'vPartCdr3')" @update:model-value="(v: string) => updateVRegion(entry, 'vPartCdr3', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getVRegions(entry).vPartCdr3) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getVRegions(entry).vPartCdr3"
+          :error="getRegionError(entry, 'vPartCdr3')"
+          @update:model-value="(v: string) => updateVRegion(entry, 'vPartCdr3', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getVRegions(entry).vPartCdr3) || "-" }}</div>
       </div>
 
-      <div class="gene-section-title">J gene ({{ entry.name ? entry.name + '_Jgene' : '...' }})</div>
+      <div class="gene-section-title">
+        J gene ({{ entry.name ? entry.name + "_Jgene" : "..." }})
+      </div>
       <div class="region-row">
         <div class="region-label">J part CDR3</div>
-        <PlTextField class="region-nt" :model-value="getJRegions(entry).jPartCdr3" :error="getRegionError(entry, 'jPartCdr3')" @update:model-value="(v: string) => updateJRegion(entry, 'jPartCdr3', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getJRegions(entry).jPartCdr3) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getJRegions(entry).jPartCdr3"
+          :error="getRegionError(entry, 'jPartCdr3')"
+          @update:model-value="(v: string) => updateJRegion(entry, 'jPartCdr3', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getJRegions(entry).jPartCdr3) || "-" }}</div>
       </div>
       <div class="region-row">
         <div class="region-label">FR4</div>
-        <PlTextField class="region-nt" :model-value="getJRegions(entry).fr4" :error="getRegionError(entry, 'fr4')" @update:model-value="(v: string) => updateJRegion(entry, 'fr4', v)" label="NT" />
-        <div class="region-aa">{{ translateDNA(getJRegions(entry).fr4) || '-' }}</div>
+        <PlTextField
+          class="region-nt"
+          :model-value="getJRegions(entry).fr4"
+          :error="getRegionError(entry, 'fr4')"
+          @update:model-value="(v: string) => updateJRegion(entry, 'fr4', v)"
+          label="NT"
+        />
+        <div class="region-aa">{{ translateDNA(getJRegions(entry).fr4) || "-" }}</div>
       </div>
     </div>
   </div>
diff --git a/ui/src/pages/LogsPanel.vue b/ui/src/pages/LogsPanel.vue
index 48c87e2..96045da 100644
--- a/ui/src/pages/LogsPanel.vue
+++ b/ui/src/pages/LogsPanel.vue
@@ -1,7 +1,7 @@
 <script setup lang="ts">
-import { PlLogView } from '@platforma-sdk/ui-vue';
-import { computed } from 'vue';
-import { useApp } from '../app';
+import { PlLogView } from "@platforma-sdk/ui-vue";
+import { computed } from "vue";
+import { useApp } from "../app";
 
 const app = useApp();
 
@@ -11,15 +11,11 @@ const debugOutput = computed(() => app.model.outputs.debugOutput);
 
 <template>
   <div v-if="debugOutput">
-    <PlLogView
-      :log-handle="debugOutput"
-      label="MiXCR Amplicon Alignment Logs"
-    />
+    <PlLogView :log-handle="debugOutput" label="MiXCR Amplicon Alignment Logs" />
   </div>
   <div v-else>
     <p>
-      No logs available yet. Logs will appear once the reference library
-      generation process starts.
+      No logs available yet. Logs will appear once the reference library generation process starts.
     </p>
   </div>
 </template>
diff --git a/ui/src/pages/MainPage.vue b/ui/src/pages/MainPage.vue
index 68aa32c..1afd706 100644
--- a/ui/src/pages/MainPage.vue
+++ b/ui/src/pages/MainPage.vue
@@ -1,8 +1,8 @@
 <script setup lang="ts">
-import { AgGridVue } from 'ag-grid-vue3';
+import { AgGridVue } from "ag-grid-vue3";
 
-import { plRefsEqual } from '@platforma-sdk/model';
-import type { PlAgHeaderComponentParams } from '@platforma-sdk/ui-vue';
+import { plRefsEqual } from "@platforma-sdk/model";
+import type { PlAgHeaderComponentParams } from "@platforma-sdk/ui-vue";
 import {
   AgGridTheme,
   PlAgChartStackedBarCell,
@@ -16,26 +16,21 @@ import {
   autoSizeRowNumberColumn,
   createAgGridColDef,
   makeRowNumberColDef,
-} from '@platforma-sdk/ui-vue';
-import { whenever } from '@vueuse/core';
-import type {
-  ColDef,
-  GridApi,
-  GridOptions,
-  GridReadyEvent,
-} from 'ag-grid-enterprise';
-import { ClientSideRowModelModule, ModuleRegistry } from 'ag-grid-enterprise';
-import { computed, reactive, ref, shallowRef, watch, watchEffect } from 'vue';
-import { useApp } from '../app';
-import { getAlignmentChartSettings } from '../charts/alignmentChartSettings';
-import { parseProgressString } from '../parseProgress';
-import type { AmpliconAlignmentResult } from '../results';
-import { resultMap } from '../results';
-import LogsPanel from './LogsPanel.vue';
-import SampleReportPanel from './SampleReportPanel.vue';
-import SettingsPanel from './SettingsPanel.vue';
-import { ExportRawBtn } from '../ExportRawBtn';
-import { ChunkedStreamReader } from '../ChunkedStreamReader';
+} from "@platforma-sdk/ui-vue";
+import { whenever } from "@vueuse/core";
+import type { ColDef, GridApi, GridOptions, GridReadyEvent } from "ag-grid-enterprise";
+import { ClientSideRowModelModule, ModuleRegistry } from "ag-grid-enterprise";
+import { computed, reactive, ref, shallowRef, watch, watchEffect } from "vue";
+import { useApp } from "../app";
+import { getAlignmentChartSettings } from "../charts/alignmentChartSettings";
+import { parseProgressString } from "../parseProgress";
+import type { AmpliconAlignmentResult } from "../results";
+import { resultMap } from "../results";
+import LogsPanel from "./LogsPanel.vue";
+import SampleReportPanel from "./SampleReportPanel.vue";
+import SettingsPanel from "./SettingsPanel.vue";
+import { ExportRawBtn } from "../ExportRawBtn";
+import { ChunkedStreamReader } from "../ChunkedStreamReader";
 
 const app = useApp();
 
@@ -59,18 +54,16 @@ watchEffect(() => {
   if (app.model.args.assemblingFeature) {
     parts.push(app.model.args.assemblingFeature);
   }
-  app.model.args.defaultBlockLabel = parts.filter(Boolean).join(' - ');
+  app.model.args.defaultBlockLabel = parts.filter(Boolean).join(" - ");
 });
 
-const result = computed(() =>
-  resultMap.value ? [...resultMap.value.values()] : undefined,
-);
+const result = computed(() => (resultMap.value ? [...resultMap.value.values()] : undefined));
 
 const loadingOverlayParams = computed(() => {
   if (app.model.outputs.started) {
-    return { variant: 'running' as const, runningText: 'Loading Sample List' };
+    return { variant: "running" as const, runningText: "Loading Sample List" };
   }
-  return { variant: 'not-ready' as const };
+  return { variant: "not-ready" as const };
 });
 
 const data = reactive<{
@@ -122,11 +115,11 @@ const defaultColumnDef: ColDef = {
 const columnDefs: ColDef<AmpliconAlignmentResult>[] = [
   makeRowNumberColDef(),
   createAgGridColDef<AmpliconAlignmentResult, string>({
-    colId: 'label',
-    field: 'label',
-    headerName: 'Sample',
-    headerComponentParams: { type: 'Text' } satisfies PlAgHeaderComponentParams,
-    pinned: 'left',
+    colId: "label",
+    field: "label",
+    headerName: "Sample",
+    headerComponentParams: { type: "Text" } satisfies PlAgHeaderComponentParams,
+    pinned: "left",
     lockPinned: true,
     sortable: true,
     cellRenderer: PlAgTextAndButtonCell,
@@ -135,37 +128,37 @@ const columnDefs: ColDef<AmpliconAlignmentResult>[] = [
     },
   }),
   createAgGridColDef<AmpliconAlignmentResult, string>({
-    colId: 'progress',
-    field: 'progress',
-    headerName: 'Progress',
+    colId: "progress",
+    field: "progress",
+    headerName: "Progress",
     headerComponentParams: {
-      type: 'Progress',
+      type: "Progress",
     } satisfies PlAgHeaderComponentParams,
     progress(cellData) {
       const parsed = parseProgressString(cellData);
 
-      if (parsed.stage === 'Queued') {
+      if (parsed.stage === "Queued") {
         return {
-          status: 'not_started',
+          status: "not_started",
           text: parsed.stage,
         };
       }
 
       return {
-        status: parsed.stage === 'Done' ? 'done' : 'running',
+        status: parsed.stage === "Done" ? "done" : "running",
         percent: parsed.percentage,
         text: parsed.stage,
-        suffix: parsed.etaLabel ?? '',
+        suffix: parsed.etaLabel ?? "",
       };
     },
   }),
   createAgGridColDef<AmpliconAlignmentResult, string>({
-    colId: 'alignmentStats',
-    headerName: 'Alignments',
-    headerComponentParams: { type: 'Text' } satisfies PlAgHeaderComponentParams,
+    colId: "alignmentStats",
+    headerName: "Alignments",
+    headerComponentParams: { type: "Text" } satisfies PlAgHeaderComponentParams,
     flex: 1,
     cellStyle: {
-      '--ag-cell-horizontal-padding': '12px',
+      "--ag-cell-horizontal-padding": "12px",
     },
     cellRendererSelector: (cellData) => {
       const value = getAlignmentChartSettings(cellData.data?.alignReport);
@@ -202,11 +195,13 @@ const downloadLibrary = async () => {
   try {
     downloadingLibrary.value = true;
     const fileHandle = await window.showSaveFilePicker({
-      types: [{
-        description: 'JSON files',
-        accept: { 'application/json': ['.json'] },
-      }],
-      suggestedName: 'referenceLibrary.json',
+      types: [
+        {
+          description: "JSON files",
+          accept: { "application/json": [".json"] },
+        },
+      ],
+      suggestedName: "referenceLibrary.json",
     });
     const writable = await fileHandle.createWritable();
     const reader = new ChunkedStreamReader(lib.handle, lib.size);
@@ -223,11 +218,13 @@ const downloadLibrary = async () => {
 </script>
 
 <template>
-  <PlBlockPage
-    title="MiXCR Amplicon Alignment"
-  >
+  <PlBlockPage title="MiXCR Amplicon Alignment">
     <template #append>
-      <PlBtnGhost :disabled="!isLibraryReady" :loading="downloadingLibrary" @click.stop="downloadLibrary">
+      <PlBtnGhost
+        :disabled="!isLibraryReady"
+        :loading="downloadingLibrary"
+        @click.stop="downloadLibrary"
+      >
         Export Library
         <template #append><PlMaskIcon24 name="download" /></template>
       </PlBtnGhost>
@@ -262,11 +259,7 @@ const downloadLibrary = async () => {
     </div>
   </PlBlockPage>
 
-  <PlSlideModal
-    v-model="data.logsOpen"
-    :close-on-outside-click="false"
-    width="100%"
-  >
+  <PlSlideModal v-model="data.logsOpen" :close-on-outside-click="false" width="100%">
     <template #title>Reference Library Generation Logs</template>
     <LogsPanel />
   </PlSlideModal>
@@ -289,9 +282,8 @@ const downloadLibrary = async () => {
     <template #title>
       Results for
       {{
-        (data.selectedSample
-          ? app.model.outputs.sampleLabels?.[data.selectedSample]
-          : undefined) ?? "..."
+        (data.selectedSample ? app.model.outputs.sampleLabels?.[data.selectedSample] : undefined) ??
+        "..."
       }}
     </template>
     <SampleReportPanel v-model="data.selectedSample" />
diff --git a/ui/src/pages/QcReportTablePage.vue b/ui/src/pages/QcReportTablePage.vue
index 235241d..d0c9eef 100644
--- a/ui/src/pages/QcReportTablePage.vue
+++ b/ui/src/pages/QcReportTablePage.vue
@@ -1,24 +1,17 @@
 <script setup lang="ts">
-import { useApp } from '../app';
-import {
-  PlAgDataTableV2,
-  PlBlockPage,
-  usePlDataTableSettingsV2,
-} from '@platforma-sdk/ui-vue';
+import { useApp } from "../app";
+import { PlAgDataTableV2, PlBlockPage, usePlDataTableSettingsV2 } from "@platforma-sdk/ui-vue";
 
 const app = useApp();
 
 const tableSettings = usePlDataTableSettingsV2({
   model: () => app.model.outputs.pt,
 });
-
 </script>
 
 <template>
   <PlBlockPage>
-    <template #title>
-      QC Report Table
-    </template>
+    <template #title> QC Report Table </template>
     <PlAgDataTableV2
       v-model="app.model.ui.tableState"
       :settings="tableSettings"
diff --git a/ui/src/pages/SampleReportPanel.vue b/ui/src/pages/SampleReportPanel.vue
index cbde767..3eab4fa 100644
--- a/ui/src/pages/SampleReportPanel.vue
+++ b/ui/src/pages/SampleReportPanel.vue
@@ -1,53 +1,43 @@
 <script setup lang="ts">
-import { computed, reactive } from 'vue';
-import type { SimpleOption } from '@platforma-sdk/ui-vue';
-import { PlBtnGroup } from '@platforma-sdk/ui-vue';
-import { resultMap } from '../results';
-import SampleReportPanelLog from './SampleReportPanelLog.vue';
-import SampleReportPanelReports from './SampleReportPanelReports.vue';
-import SampleReportPanelVisualReport from './SampleReportPanelVisualReport.vue';
+import { computed, reactive } from "vue";
+import type { SimpleOption } from "@platforma-sdk/ui-vue";
+import { PlBtnGroup } from "@platforma-sdk/ui-vue";
+import { resultMap } from "../results";
+import SampleReportPanelLog from "./SampleReportPanelLog.vue";
+import SampleReportPanelReports from "./SampleReportPanelReports.vue";
+import SampleReportPanelVisualReport from "./SampleReportPanelVisualReport.vue";
 
 const sampleId = defineModel<string | undefined>();
 
 const sampleData = computed(() => {
-  if (sampleId.value === undefined || resultMap.value === undefined)
-    return undefined;
+  if (sampleId.value === undefined || resultMap.value === undefined) return undefined;
   return resultMap.value.get(sampleId.value);
 });
 
-type TabId = 'visualReport' | 'reports' | 'logs';
+type TabId = "visualReport" | "reports" | "logs";
 
 const data = reactive<{
   currentTab: TabId;
 }>({
-  currentTab: 'visualReport',
+  currentTab: "visualReport",
 });
 
 const tabOptions: SimpleOption<TabId>[] = [
-  { value: 'visualReport', text: 'Visual Report' },
-  { value: 'reports', text: 'Reports' },
-  { value: 'logs', text: 'Log' },
+  { value: "visualReport", text: "Visual Report" },
+  { value: "reports", text: "Reports" },
+  { value: "logs", text: "Log" },
 ];
 </script>
 
 <template>
   <PlBtnGroup v-model="data.currentTab" :options="tabOptions" />
-  <div
-    v-if="sampleId !== undefined && sampleData !== undefined"
-    class="pl-scrollable"
-  >
+  <div v-if="sampleId !== undefined && sampleData !== undefined" class="pl-scrollable">
     <SampleReportPanelVisualReport
       v-if="data.currentTab === 'visualReport'"
       :sample-data="sampleData"
     />
-    <SampleReportPanelReports
-      v-else-if="data.currentTab === 'reports'"
-      :sample-id="sampleId"
-    />
-    <SampleReportPanelLog
-      v-else-if="data.currentTab === 'logs'"
-      :sample-data="sampleData"
-    />
+    <SampleReportPanelReports v-else-if="data.currentTab === 'reports'" :sample-id="sampleId" />
+    <SampleReportPanelLog v-else-if="data.currentTab === 'logs'" :sample-data="sampleData" />
   </div>
   <div v-else>No sample selected</div>
 </template>
diff --git a/ui/src/pages/SampleReportPanelLog.vue b/ui/src/pages/SampleReportPanelLog.vue
index 6b81ffa..f7671bc 100644
--- a/ui/src/pages/SampleReportPanelLog.vue
+++ b/ui/src/pages/SampleReportPanelLog.vue
@@ -1,6 +1,6 @@
 <script setup lang="ts">
-import { PlLogView } from '@platforma-sdk/ui-vue';
-import type { AmpliconAlignmentResult } from '../results';
+import { PlLogView } from "@platforma-sdk/ui-vue";
+import type { AmpliconAlignmentResult } from "../results";
 
 defineProps<{
   sampleData: AmpliconAlignmentResult;
diff --git a/ui/src/pages/SampleReportPanelReports.vue b/ui/src/pages/SampleReportPanelReports.vue
index 4acfe84..9d2f6bd 100644
--- a/ui/src/pages/SampleReportPanelReports.vue
+++ b/ui/src/pages/SampleReportPanelReports.vue
@@ -1,23 +1,18 @@
 <script setup lang="ts">
-import type { SimpleOption } from '@platforma-sdk/ui-vue';
-import {
-  PlBtnGroup,
-  PlContainer,
-  PlTextArea,
-  ReactiveFileContent,
-} from '@platforma-sdk/ui-vue';
-import { computed, reactive } from 'vue';
-import { useApp } from '../app';
+import type { SimpleOption } from "@platforma-sdk/ui-vue";
+import { PlBtnGroup, PlContainer, PlTextArea, ReactiveFileContent } from "@platforma-sdk/ui-vue";
+import { computed, reactive } from "vue";
+import { useApp } from "../app";
 
 const props = defineProps<{
   sampleId: string;
 }>();
 
-type ReportId = 'align' | 'assemble';
+type ReportId = "align" | "assemble";
 const data = reactive<{
   currentReport: ReportId;
 }>({
-  currentReport: 'align',
+  currentReport: "align",
 });
 
 const app = useApp();
@@ -27,10 +22,7 @@ const reactiveFileContent = ReactiveFileContent.useGlobal();
 const reportHandle = computed(() => {
   const sampleId = props.sampleId;
   return app.model.outputs.reports?.data?.find(
-    (d) =>
-      d.key[0] === sampleId
-      && d.key[1] === data.currentReport
-      && d.key[2] === 'txt',
+    (d) => d.key[0] === sampleId && d.key[1] === data.currentReport && d.key[2] === "txt",
   )?.value?.handle;
 });
 
@@ -39,8 +31,8 @@ const reportContent = computed(
 );
 
 const tabOptions: SimpleOption<ReportId>[] = [
-  { value: 'align', text: 'Align' },
-  { value: 'assemble', text: 'Assemble' },
+  { value: "align", text: "Align" },
+  { value: "assemble", text: "Assemble" },
 ];
 </script>
 
diff --git a/ui/src/pages/SampleReportPanelVisualReport.vue b/ui/src/pages/SampleReportPanelVisualReport.vue
index 3bb4f3a..f54291f 100644
--- a/ui/src/pages/SampleReportPanelVisualReport.vue
+++ b/ui/src/pages/SampleReportPanelVisualReport.vue
@@ -1,6 +1,6 @@
 <script setup lang="ts">
-import type { AmpliconAlignmentResult } from '../results';
-import AlignmentsChart from '../charts/AlignmentsChart.vue';
+import type { AmpliconAlignmentResult } from "../results";
+import AlignmentsChart from "../charts/AlignmentsChart.vue";
 
 defineProps<{
   sampleData: AmpliconAlignmentResult;
diff --git a/ui/src/pages/SettingsPanel.vue b/ui/src/pages/SettingsPanel.vue
index a248683..1eaab2d 100644
--- a/ui/src/pages/SettingsPanel.vue
+++ b/ui/src/pages/SettingsPanel.vue
@@ -1,7 +1,7 @@
 <script setup lang="ts">
-import type { ReferenceInputMode } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
-import type { ImportFileHandle, LocalImportFileHandle, PlRef } from '@platforma-sdk/model';
-import { getFilePathFromHandle, getRawPlatformaInstance } from '@platforma-sdk/model';
+import type { ReferenceInputMode } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
+import type { ImportFileHandle, LocalImportFileHandle, PlRef } from "@platforma-sdk/model";
+import { getFilePathFromHandle, getRawPlatformaInstance } from "@platforma-sdk/model";
 import {
   PlAccordionSection,
   PlBtnGroup,
@@ -15,36 +15,40 @@ import {
   PlTextArea,
   PlTextField,
   type ListOption,
-} from '@platforma-sdk/ui-vue';
-import { computed, ref, watch } from 'vue';
-import { useApp } from '../app';
-import { parseFasta, parseFastaRecords } from '../utils/parseFasta';
-import BuildLibraryPanel from './BuildLibraryPanel.vue';
+} from "@platforma-sdk/ui-vue";
+import { computed, ref, watch } from "vue";
+import { useApp } from "../app";
+import { parseFasta, parseFastaRecords } from "../utils/parseFasta";
+import BuildLibraryPanel from "./BuildLibraryPanel.vue";
 
 const app = useApp();
 
 const refModeOptions: ListOption<ReferenceInputMode>[] = [
-  { label: 'FASTA sequence', value: 'fastaSequence' },
-  { label: 'FASTA file', value: 'fastaFile' },
-  { label: 'Library file', value: 'libraryFile' },
-  { label: 'Build library', value: 'buildLibrary' },
+  { label: "FASTA sequence", value: "fastaSequence" },
+  { label: "FASTA file", value: "fastaFile" },
+  { label: "Library file", value: "libraryFile" },
+  { label: "Build library", value: "buildLibrary" },
 ];
 
 const refMode = computed<ReferenceInputMode>({
-  get: () => app.model.ui.referenceInputMode ?? 'fastaSequence',
+  get: () => app.model.ui.referenceInputMode ?? "fastaSequence",
   set: (value: ReferenceInputMode) => {
     app.model.ui.referenceInputMode = value;
   },
 });
 
 function extractFileName(filePath: string) {
-  return filePath.replace(/^.*[\\/]/, '');
+  return filePath.replace(/^.*[\\/]/, "");
 }
 
 // Sync reference input mode to args so the workflow can read it
-watch(refMode, (newMode) => {
-  app.model.args.referenceInputMode = newMode;
-}, { immediate: true });
+watch(
+  refMode,
+  (newMode) => {
+    app.model.args.referenceInputMode = newMode;
+  },
+  { immediate: true },
+);
 
 // Auto-detect gzip from library file
 watch(
@@ -55,13 +59,13 @@ watch(
       return;
     }
     const libraryFileName = extractFileName(getFilePathFromHandle(newFile));
-    const isGzipped = libraryFileName?.toLowerCase().endsWith('.gz') || false;
+    const isGzipped = libraryFileName?.toLowerCase().endsWith(".gz") || false;
     app.model.args.isLibraryFileGzipped = isGzipped;
   },
 );
 
 type AssemblingFeature = string;
-type StopCodonType = 'amber' | 'ochre' | 'opal';
+type StopCodonType = "amber" | "ochre" | "opal";
 
 // Validation state management
 const fastaError = ref<string | undefined>();
@@ -70,9 +74,7 @@ const fastaError = ref<string | undefined>();
 const allRecordHeaders = ref<string[]>([]);
 const fileContent = ref<string | undefined>();
 
-const recordOptions = computed(() =>
-  allRecordHeaders.value.map((h) => ({ value: h, label: h })),
-);
+const recordOptions = computed(() => allRecordHeaders.value.map((h) => ({ value: h, label: h })));
 
 const selectedHeaders = computed({
   get: () => app.model.ui.selectedRecordHeaders ?? allRecordHeaders.value,
@@ -140,7 +142,9 @@ async function setReferenceFile(file: ImportFileHandle | undefined) {
   }
 
   try {
-    const data = await getRawPlatformaInstance().lsDriver.getLocalFileContent(file as LocalImportFileHandle);
+    const data = await getRawPlatformaInstance().lsDriver.getLocalFileContent(
+      file as LocalImportFileHandle,
+    );
     const content = new TextDecoder().decode(data);
     fileContent.value = content;
     app.model.ui.selectedRecordHeaders = undefined;
@@ -153,7 +157,7 @@ async function setReferenceFile(file: ImportFileHandle | undefined) {
       fileError.value = result.error;
     }
   } catch (e) {
-    fileError.value = `Failed to read file: ${e instanceof Error ? e.message : 'Unknown error'}`;
+    fileError.value = `Failed to read file: ${e instanceof Error ? e.message : "Unknown error"}`;
     app.model.args.vGenes = undefined;
     app.model.args.jGenes = undefined;
     clearRecordSelection();
@@ -164,15 +168,15 @@ async function setReferenceFile(file: ImportFileHandle | undefined) {
 watch(
   () => app.model.ui.librarySequence,
   (newSequence) => {
-    if (refMode.value !== 'fastaSequence') return;
-    if ((newSequence || '').trim()) {
+    if (refMode.value !== "fastaSequence") return;
+    if ((newSequence || "").trim()) {
       // Clear file input when text is entered
       app.model.args.referenceFileHandle = undefined;
       fileError.value = undefined;
       fileContent.value = undefined;
       app.model.ui.selectedRecordHeaders = undefined;
 
-      processContent(newSequence || '');
+      processContent(newSequence || "");
     } else {
       fastaError.value = undefined;
       app.model.args.vGenes = undefined;
@@ -195,41 +199,41 @@ watch(
 );
 
 const chainOptions = [
-  { value: 'IGHeavy', label: 'IG Heavy' },
-  { value: 'IGLight', label: 'IG Light' },
-  { value: 'TCRAlpha', label: 'TCR-α' },
-  { value: 'TCRBeta', label: 'TCR-β' },
-  { value: 'TCRGamma', label: 'TCR-ɣ' },
-  { value: 'TCRDelta', label: 'TCR-δ' },
+  { value: "IGHeavy", label: "IG Heavy" },
+  { value: "IGLight", label: "IG Light" },
+  { value: "TCRAlpha", label: "TCR-α" },
+  { value: "TCRBeta", label: "TCR-β" },
+  { value: "TCRGamma", label: "TCR-ɣ" },
+  { value: "TCRDelta", label: "TCR-δ" },
 ];
 
 const chains = computed({
-  get: () => app.model.args.chains ?? 'IGHeavy',
+  get: () => app.model.args.chains ?? "IGHeavy",
   set: (value: string) => {
     app.model.args.chains = value;
   },
 });
 
 const clusteringOptions = [
-  { value: 'relaxed', label: 'Relaxed error correction, faster assembly' },
-  { value: 'default', label: 'Default MiXCR error correction, slower assembly' },
-  { value: 'off', label: 'No error correction, fastest assembly' },
+  { value: "relaxed", label: "Relaxed error correction, faster assembly" },
+  { value: "default", label: "Default MiXCR error correction, slower assembly" },
+  { value: "off", label: "No error correction, fastest assembly" },
 ] as const;
 
 const assemblingFeatureOptions = [
-  { value: 'VDJRegion', label: 'VDJRegion' },
-  { value: 'CDR3', label: 'CDR3' },
-  { value: 'FR1:FR4', label: 'FR1:FR4' },
-  { value: 'CDR1:FR4', label: 'CDR1:FR4' },
-  { value: 'FR2:FR4', label: 'FR2:FR4' },
-  { value: 'CDR2:FR4', label: 'CDR2:FR4' },
-  { value: 'FR3:FR4', label: 'FR3:FR4' },
-  { value: 'CDR3:FR4', label: 'CDR3:FR4' },
-  { value: 'FR1:CDR3', label: 'FR1:CDR3' },
-  { value: 'CDR1:CDR3', label: 'CDR1:CDR3' },
-  { value: 'FR2:CDR3', label: 'FR2:CDR3' },
-  { value: 'CDR2:CDR3', label: 'CDR2:CDR3' },
-  { value: 'FR3:CDR3', label: 'FR3:CDR3' },
+  { value: "VDJRegion", label: "VDJRegion" },
+  { value: "CDR3", label: "CDR3" },
+  { value: "FR1:FR4", label: "FR1:FR4" },
+  { value: "CDR1:FR4", label: "CDR1:FR4" },
+  { value: "FR2:FR4", label: "FR2:FR4" },
+  { value: "CDR2:FR4", label: "CDR2:FR4" },
+  { value: "FR3:FR4", label: "FR3:FR4" },
+  { value: "CDR3:FR4", label: "CDR3:FR4" },
+  { value: "FR1:CDR3", label: "FR1:CDR3" },
+  { value: "CDR1:CDR3", label: "CDR1:CDR3" },
+  { value: "FR2:CDR3", label: "FR2:CDR3" },
+  { value: "CDR2:CDR3", label: "CDR2:CDR3" },
+  { value: "FR3:CDR3", label: "FR3:CDR3" },
 ];
 
 const assemblingFeature = computed<AssemblingFeature>({
@@ -247,32 +251,32 @@ const imputeGermline = computed({
 });
 
 const stopCodonOptions: ListOption<StopCodonType>[] = [
-  { label: 'Amber (TAG)', value: 'amber' },
-  { label: 'Ochre (TAA)', value: 'ochre' },
-  { label: 'Opal/Umber (TGA)', value: 'opal' },
+  { label: "Amber (TAG)", value: "amber" },
+  { label: "Ochre (TAA)", value: "ochre" },
+  { label: "Opal/Umber (TGA)", value: "opal" },
 ];
 
 const aminoAcidOptions: ListOption[] = [
-  { label: 'A (Ala)', value: 'A' },
-  { label: 'C (Cys)', value: 'C' },
-  { label: 'D (Asp)', value: 'D' },
-  { label: 'E (Glu)', value: 'E' },
-  { label: 'F (Phe)', value: 'F' },
-  { label: 'G (Gly)', value: 'G' },
-  { label: 'H (His)', value: 'H' },
-  { label: 'I (Ile)', value: 'I' },
-  { label: 'K (Lys)', value: 'K' },
-  { label: 'L (Leu)', value: 'L' },
-  { label: 'M (Met)', value: 'M' },
-  { label: 'N (Asn)', value: 'N' },
-  { label: 'P (Pro)', value: 'P' },
-  { label: 'Q (Gln)', value: 'Q' },
-  { label: 'R (Arg)', value: 'R' },
-  { label: 'S (Ser)', value: 'S' },
-  { label: 'T (Thr)', value: 'T' },
-  { label: 'V (Val)', value: 'V' },
-  { label: 'W (Trp)', value: 'W' },
-  { label: 'Y (Tyr)', value: 'Y' },
+  { label: "A (Ala)", value: "A" },
+  { label: "C (Cys)", value: "C" },
+  { label: "D (Asp)", value: "D" },
+  { label: "E (Glu)", value: "E" },
+  { label: "F (Phe)", value: "F" },
+  { label: "G (Gly)", value: "G" },
+  { label: "H (His)", value: "H" },
+  { label: "I (Ile)", value: "I" },
+  { label: "K (Lys)", value: "K" },
+  { label: "L (Leu)", value: "L" },
+  { label: "M (Met)", value: "M" },
+  { label: "N (Asn)", value: "N" },
+  { label: "P (Pro)", value: "P" },
+  { label: "Q (Gln)", value: "Q" },
+  { label: "R (Arg)", value: "R" },
+  { label: "S (Ser)", value: "S" },
+  { label: "T (Thr)", value: "T" },
+  { label: "V (Val)", value: "V" },
+  { label: "W (Trp)", value: "W" },
+  { label: "Y (Tyr)", value: "Y" },
 ];
 
 const stopCodonSelection = computed({
@@ -291,16 +295,17 @@ const stopCodonReplacementModel = (type: StopCodonType) =>
         if (current[type] !== undefined) {
           delete current[type];
         }
-        app.model.args.stopCodonReplacements = Object.keys(current).length > 0 ? current : undefined;
+        app.model.args.stopCodonReplacements =
+          Object.keys(current).length > 0 ? current : undefined;
       } else {
         app.model.args.stopCodonReplacements = { ...current, [type]: value };
       }
     },
   });
 
-const amberReplacement = stopCodonReplacementModel('amber');
-const ochreReplacement = stopCodonReplacementModel('ochre');
-const opalReplacement = stopCodonReplacementModel('opal');
+const amberReplacement = stopCodonReplacementModel("amber");
+const ochreReplacement = stopCodonReplacementModel("ochre");
+const opalReplacement = stopCodonReplacementModel("opal");
 
 watch(stopCodonSelection, (selected) => {
   const current = app.model.args.stopCodonReplacements;
@@ -311,7 +316,6 @@ watch(stopCodonSelection, (selected) => {
   }
   app.model.args.stopCodonReplacements = Object.keys(next).length > 0 ? next : undefined;
 });
-
 </script>
 
 <template>
@@ -336,7 +340,9 @@ watch(stopCodonSelection, (selected) => {
       @update:model-value="setReferenceFile"
     >
       <template #tooltip>
-        Import a FASTA file with nucleotide reference sequence(s). Multiple FASTA records are supported. The header will be used as part of V and J gene names (e.g., header_Vgene, header_Jgene). The sequence must cover VDJRegion.
+        Import a FASTA file with nucleotide reference sequence(s). Multiple FASTA records are
+        supported. The header will be used as part of V and J gene names (e.g., header_Vgene,
+        header_Jgene). The sequence must cover VDJRegion.
       </template>
     </PlFileInput>
 
@@ -363,7 +369,9 @@ ATCGATCGATCG..."
       :error="fastaError"
     >
       <template #tooltip>
-        Paste the nucleotide sequence(s) in FASTA format. Multiple FASTA records are supported. The header will be used as part of V and J gene names (e.g., header_Vgene, header_Jgene). The sequence must cover VDJRegion.
+        Paste the nucleotide sequence(s) in FASTA format. Multiple FASTA records are supported. The
+        header will be used as part of V and J gene names (e.g., header_Vgene, header_Jgene). The
+        sequence must cover VDJRegion.
       </template>
     </PlTextArea>
 
@@ -391,28 +399,17 @@ ATCGATCGATCG..."
 
   <BuildLibraryPanel v-else-if="refMode === 'buildLibrary'" />
 
-  <PlDropdown
-    v-model="chains"
-    :options="chainOptions"
-    label="Chain selection"
-    :required="true"
-  />
+  <PlDropdown v-model="chains" :options="chainOptions" label="Chain selection" :required="true" />
 
   <PlDropdown
     v-model="assemblingFeature"
     :options="assemblingFeatureOptions"
     label="Assembling feature"
   >
-    <template #tooltip>
-      Select the region used to assemble clonotypes.
-    </template>
+    <template #tooltip> Select the region used to assemble clonotypes. </template>
   </PlDropdown>
 
-  <PlCheckbox
-    v-model="imputeGermline"
-  >
-    Impute non-covered parts from germline
-  </PlCheckbox>
+  <PlCheckbox v-model="imputeGermline"> Impute non-covered parts from germline </PlCheckbox>
 
   <PlTextField
     v-model="app.model.args.tagPattern"
@@ -421,7 +418,8 @@ ATCGATCGATCG..."
     clearable
   >
     <template #tooltip>
-      Tag pattern for primer trimming, UMI extraction etc. Support MiXCR pattern syntax. Can be left empty.
+      Tag pattern for primer trimming, UMI extraction etc. Support MiXCR pattern syntax. Can be left
+      empty.
     </template>
   </PlTextField>
 
@@ -433,10 +431,9 @@ ATCGATCGATCG..."
       label="Error correction"
     >
       <template #tooltip>
-        'Default assembly' is the standard MiXCR clustering
-        mode. 'Faster assembly' relaxes fuzzy matching
-        criteria, speeding up assembly. 'Fastest assembly' further accelerates the process but disables error
-        correction.
+        'Default assembly' is the standard MiXCR clustering mode. 'Faster assembly' relaxes fuzzy
+        matching criteria, speeding up assembly. 'Fastest assembly' further accelerates the process
+        but disables error correction.
       </template>
     </PlDropdown>
     <PlNumberField
@@ -449,10 +446,11 @@ ATCGATCGATCG..."
       :validate="(v) => (Number.isInteger(v) ? undefined : 'Value must be an integer')"
     >
       <template #tooltip>
-        Per-position base quality threshold for clonotype assembly. Reads where all positions meet this threshold
-        directly seed new clonotypes; reads with any position below it are deferred and mapped to existing clonotypes
-        instead. Increase this value (e.g. 20–25) for long-read data (ONT, PacBio) to reduce memory usage and
-        prevent erroneous reads from creating spurious clonotypes. Leave empty to use the MiXCR default (15).
+        Per-position base quality threshold for clonotype assembly. Reads where all positions meet
+        this threshold directly seed new clonotypes; reads with any position below it are deferred
+        and mapped to existing clonotypes instead. Increase this value (e.g. 20–25) for long-read
+        data (ONT, PacBio) to reduce memory usage and prevent erroneous reads from creating spurious
+        clonotypes. Leave empty to use the MiXCR default (15).
       </template>
     </PlNumberField>
     <PlNumberField
@@ -468,9 +466,7 @@ ATCGATCGATCG..."
       :options="stopCodonOptions"
       clearable
     >
-      <template #tooltip>
-        Select stop codons to replace in amino acid sequences.
-      </template>
+      <template #tooltip> Select stop codons to replace in amino acid sequences. </template>
     </PlDropdownMulti>
     <PlDropdown
       v-if="stopCodonSelection.includes('amber')"
diff --git a/ui/src/parseProgress.ts b/ui/src/parseProgress.ts
index 61dd2f0..5356616 100644
--- a/ui/src/parseProgress.ts
+++ b/ui/src/parseProgress.ts
@@ -1,7 +1,7 @@
 // This utility is adapted from other blocks in the repository
 // It can be moved to a shared SDK package in the future
 
-import { ProgressPattern } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
+import { ProgressPattern } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
 
 type ParsedProgress = {
   raw?: string;
@@ -20,10 +20,8 @@ type ParsedProgress = {
 // 'Exporting clones: 11.1%'
 // 'Queued'
 // 'Done'
-export function parseProgressString(
-  progressString: string | undefined | null,
-): ParsedProgress {
-  const raw = progressString ?? 'Unknown';
+export function parseProgressString(progressString: string | undefined | null): ParsedProgress {
+  const raw = progressString ?? "Unknown";
 
   const res: ParsedProgress = {
     raw,
diff --git a/ui/src/results.ts b/ui/src/results.ts
index cffc033..54ebb80 100644
--- a/ui/src/results.ts
+++ b/ui/src/results.ts
@@ -1,11 +1,11 @@
 // This file is intentionally left empty.
 // The results logic was removed as the table was removed from the UI.
 
-import type { AlignReport as ModelAlignReport } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
-import type { AnyLogHandle } from '@platforma-sdk/model';
-import { ReactiveFileContent } from '@platforma-sdk/ui-vue';
-import { computed } from 'vue';
-import { useApp } from './app';
+import type { AlignReport as ModelAlignReport } from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
+import type { AnyLogHandle } from "@platforma-sdk/model";
+import { ReactiveFileContent } from "@platforma-sdk/ui-vue";
+import { computed } from "vue";
+import { useApp } from "./app";
 
 export type AlignReport = ModelAlignReport;
 export type AssembleReport = Record<string, unknown>;
@@ -34,7 +34,7 @@ export const AmpliconAlignmentResultsMap = computed(() => {
   for (const sampleId in sampleLabels) {
     const result: AmpliconAlignmentResult = {
       sampleId: sampleId,
-      progress: 'Queued',
+      progress: "Queued",
       label: sampleLabels[sampleId] ?? `<no label / ${sampleId}>`,
     };
     resultMap.set(sampleId, result);
@@ -44,8 +44,7 @@ export const AmpliconAlignmentResultsMap = computed(() => {
   if (logs)
     for (const logData of logs.data) {
       const sampleId = logData.key[0] as string;
-      if (resultMap.get(sampleId))
-        resultMap.get(sampleId)!.logHandle = logData.value;
+      if (resultMap.get(sampleId)) resultMap.get(sampleId)!.logHandle = logData.value;
     }
 
   const reports = app.model.outputs.reports;
@@ -53,22 +52,20 @@ export const AmpliconAlignmentResultsMap = computed(() => {
     for (const report of reports.data) {
       const sampleId = report.key[0] as string;
       const reportId = report.key[1] as string;
-      if (report.key[2] !== 'json' || report.value === undefined) continue;
+      if (report.key[2] !== "json" || report.value === undefined) continue;
       if (resultMap.get(sampleId))
         switch (reportId) {
-          case 'align':
+          case "align":
             // globally cached
-            resultMap.get(sampleId)!.alignReport
-            = reactiveFileContent.getContentJson(report.value.handle)?.value as
-            | AlignReport
-            | undefined;
+            resultMap.get(sampleId)!.alignReport = reactiveFileContent.getContentJson(
+              report.value.handle,
+            )?.value as AlignReport | undefined;
             break;
-          case 'assemble':
+          case "assemble":
             // globally cached
-            resultMap.get(sampleId)!.assembleReport
-            = reactiveFileContent.getContentJson(report.value.handle)?.value as
-            | AssembleReport
-            | undefined;
+            resultMap.get(sampleId)!.assembleReport = reactiveFileContent.getContentJson(
+              report.value.handle,
+            )?.value as AssembleReport | undefined;
             break;
         }
     }
@@ -77,9 +74,7 @@ export const AmpliconAlignmentResultsMap = computed(() => {
 });
 
 /** Results augmented with execution progress */
-export const resultMap = computed<
-  Map<string, AmpliconAlignmentResult> | undefined
->(() => {
+export const resultMap = computed<Map<string, AmpliconAlignmentResult> | undefined>(() => {
   const app = useApp();
 
   const rawMap = AmpliconAlignmentResultsMap.value;
@@ -99,8 +94,8 @@ export const resultMap = computed<
       if (resultMap.get(sampleId))
         if (p?.value)
           resultMap.get(sampleId)!.progress = done.has(sampleId)
-            ? 'Done'
-            : p.value?.replace('[==PROGRESS==]', '') ?? 'Not started';
+            ? "Done"
+            : (p.value?.replace("[==PROGRESS==]", "") ?? "Not started");
     }
   }
 
diff --git a/ui/src/retentive.ts b/ui/src/retentive.ts
index 843c8bb..4008e32 100644
--- a/ui/src/retentive.ts
+++ b/ui/src/retentive.ts
@@ -2,8 +2,8 @@
 // Workaround before we add access to "retentive mode" behaviour in model SDK
 //
 
-import type { Ref } from 'vue';
-import { shallowRef, watch } from 'vue';
+import type { Ref } from "vue";
+import { shallowRef, watch } from "vue";
 
 export function retentive<T>(input: Ref<T | undefined>): Ref<T | undefined> {
   const result = shallowRef(input.value);
diff --git a/ui/src/simpleRetry.ts b/ui/src/simpleRetry.ts
index 397f8ff..d79008d 100644
--- a/ui/src/simpleRetry.ts
+++ b/ui/src/simpleRetry.ts
@@ -1,4 +1,4 @@
-import { ensureError, isAbortError } from '@platforma-sdk/model';
+import { ensureError, isAbortError } from "@platforma-sdk/model";
 
 const delay = (ms: number) => new Promise((resolve) => setTimeout(resolve, ms));
 
diff --git a/ui/src/utils/buildLibrary.ts b/ui/src/utils/buildLibrary.ts
index 59d8963..d17d83d 100644
--- a/ui/src/utils/buildLibrary.ts
+++ b/ui/src/utils/buildLibrary.ts
@@ -1,26 +1,34 @@
-import type { LibraryEntryDefinition, VAnchorPoints, JAnchorPoints } from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
+import type {
+  LibraryEntryDefinition,
+  VAnchorPoints,
+  JAnchorPoints,
+} from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
 
 /**
  * Extract CDR3 sequences from library entry definitions.
  * For each entry: CDR3 = vSequence[cdr3Begin:vEnd] + jSequence[jBegin:fr4Begin]
  */
-export function extractCdr3FromDefinitions(
-  entries: LibraryEntryDefinition[],
-): string | undefined {
+export function extractCdr3FromDefinitions(entries: LibraryEntryDefinition[]): string | undefined {
   const parts: string[] = [];
 
   for (const entry of entries) {
     if (!entry.vSequence || !entry.jSequence) continue;
 
-    const vCdr3 = entry.vSequence.substring(entry.vAnchorPoints.cdr3Begin, entry.vAnchorPoints.vEnd);
-    const jCdr3 = entry.jSequence.substring(entry.jAnchorPoints.jBegin, entry.jAnchorPoints.fr4Begin);
+    const vCdr3 = entry.vSequence.substring(
+      entry.vAnchorPoints.cdr3Begin,
+      entry.vAnchorPoints.vEnd,
+    );
+    const jCdr3 = entry.jSequence.substring(
+      entry.jAnchorPoints.jBegin,
+      entry.jAnchorPoints.fr4Begin,
+    );
 
     if (vCdr3.length > 0 && jCdr3.length > 0) {
       parts.push(`>${entry.name}_CDR3\n${vCdr3}${jCdr3}`);
     }
   }
 
-  return parts.length > 0 ? parts.join('\n') : undefined;
+  return parts.length > 0 ? parts.join("\n") : undefined;
 }
 
 /** V gene region sequences decomposed from anchor points */
@@ -64,8 +72,12 @@ export function getJRegions(entry: LibraryEntryDefinition): JRegions {
 }
 
 /** Recompose V gene regions into full sequence + anchor points */
-export function recomposeVGene(regions: VRegions): { vSequence: string; vAnchorPoints: VAnchorPoints } {
-  const vSequence = regions.fr1 + regions.cdr1 + regions.fr2 + regions.cdr2 + regions.fr3 + regions.vPartCdr3;
+export function recomposeVGene(regions: VRegions): {
+  vSequence: string;
+  vAnchorPoints: VAnchorPoints;
+} {
+  const vSequence =
+    regions.fr1 + regions.cdr1 + regions.fr2 + regions.cdr2 + regions.fr3 + regions.vPartCdr3;
   let pos = 0;
   const fr1Begin = pos;
   pos += regions.fr1.length;
@@ -87,7 +99,10 @@ export function recomposeVGene(regions: VRegions): { vSequence: string; vAnchorP
 }
 
 /** Recompose J gene regions into full sequence + anchor points */
-export function recomposeJGene(regions: JRegions): { jSequence: string; jAnchorPoints: JAnchorPoints } {
+export function recomposeJGene(regions: JRegions): {
+  jSequence: string;
+  jAnchorPoints: JAnchorPoints;
+} {
   const jSequence = regions.jPartCdr3 + regions.fr4;
   const jBegin = 0;
   const fr4Begin = regions.jPartCdr3.length;
@@ -99,31 +114,79 @@ export function recomposeJGene(regions: JRegions): { jSequence: string; jAnchorP
 }
 
 const codonTable: Record<string, string> = {
-  TTT: 'F', TTC: 'F', TTA: 'L', TTG: 'L',
-  TCT: 'S', TCC: 'S', TCA: 'S', TCG: 'S',
-  TAT: 'Y', TAC: 'Y', TAA: '*', TAG: '*',
-  TGT: 'C', TGC: 'C', TGA: '*', TGG: 'W',
-  CTT: 'L', CTC: 'L', CTA: 'L', CTG: 'L',
-  CCT: 'P', CCC: 'P', CCA: 'P', CCG: 'P',
-  CAT: 'H', CAC: 'H', CAA: 'Q', CAG: 'Q',
-  CGT: 'R', CGC: 'R', CGA: 'R', CGG: 'R',
-  ATT: 'I', ATC: 'I', ATA: 'I', ATG: 'M',
-  ACT: 'T', ACC: 'T', ACA: 'T', ACG: 'T',
-  AAT: 'N', AAC: 'N', AAA: 'K', AAG: 'K',
-  AGT: 'S', AGC: 'S', AGA: 'R', AGG: 'R',
-  GTT: 'V', GTC: 'V', GTA: 'V', GTG: 'V',
-  GCT: 'A', GCC: 'A', GCA: 'A', GCG: 'A',
-  GAT: 'D', GAC: 'D', GAA: 'E', GAG: 'E',
-  GGT: 'G', GGC: 'G', GGA: 'G', GGG: 'G',
+  TTT: "F",
+  TTC: "F",
+  TTA: "L",
+  TTG: "L",
+  TCT: "S",
+  TCC: "S",
+  TCA: "S",
+  TCG: "S",
+  TAT: "Y",
+  TAC: "Y",
+  TAA: "*",
+  TAG: "*",
+  TGT: "C",
+  TGC: "C",
+  TGA: "*",
+  TGG: "W",
+  CTT: "L",
+  CTC: "L",
+  CTA: "L",
+  CTG: "L",
+  CCT: "P",
+  CCC: "P",
+  CCA: "P",
+  CCG: "P",
+  CAT: "H",
+  CAC: "H",
+  CAA: "Q",
+  CAG: "Q",
+  CGT: "R",
+  CGC: "R",
+  CGA: "R",
+  CGG: "R",
+  ATT: "I",
+  ATC: "I",
+  ATA: "I",
+  ATG: "M",
+  ACT: "T",
+  ACC: "T",
+  ACA: "T",
+  ACG: "T",
+  AAT: "N",
+  AAC: "N",
+  AAA: "K",
+  AAG: "K",
+  AGT: "S",
+  AGC: "S",
+  AGA: "R",
+  AGG: "R",
+  GTT: "V",
+  GTC: "V",
+  GTA: "V",
+  GTG: "V",
+  GCT: "A",
+  GCC: "A",
+  GCA: "A",
+  GCG: "A",
+  GAT: "D",
+  GAC: "D",
+  GAA: "E",
+  GAG: "E",
+  GGT: "G",
+  GGC: "G",
+  GGA: "G",
+  GGG: "G",
 };
 
 /** Translate a nucleotide sequence to amino acids */
 export function translateDNA(nt: string): string {
-  const seq = nt.toUpperCase().replace(/\s/g, '');
-  let result = '';
+  const seq = nt.toUpperCase().replace(/\s/g, "");
+  let result = "";
   for (let i = 0; i + 2 < seq.length; i += 3) {
     const codon = seq.substring(i, i + 3);
-    result += codonTable[codon] ?? 'X';
+    result += codonTable[codon] ?? "X";
   }
   return result;
 }
diff --git a/ui/src/utils/parseFasta.ts b/ui/src/utils/parseFasta.ts
index f3560b3..c99303d 100644
--- a/ui/src/utils/parseFasta.ts
+++ b/ui/src/utils/parseFasta.ts
@@ -16,20 +16,20 @@ export interface FastaRecord {
  * @returns Array of FASTA records
  */
 export function parseFastaRecords(content: string): FastaRecord[] {
-  const lines = content.trim().split('\n');
+  const lines = content.trim().split("\n");
   const records: FastaRecord[] = [];
   let currentHeader: string | null = null;
-  let currentSequence = '';
+  let currentSequence = "";
 
   // Handle case where content might be a single sequence without a header
-  if (!content.trim().startsWith('>')) {
+  if (!content.trim().startsWith(">")) {
     const sequence = lines
       .map((l) => l.trim())
-      .join('')
+      .join("")
       .toUpperCase()
-      .replace(/\s/g, '');
+      .replace(/\s/g, "");
     if (sequence) {
-      return [{ header: '', sequence }];
+      return [{ header: "", sequence }];
     }
     return [];
   }
@@ -38,17 +38,17 @@ export function parseFastaRecords(content: string): FastaRecord[] {
     const trimmedLine = line.trim();
     if (!trimmedLine) continue;
 
-    if (trimmedLine.startsWith('>')) {
+    if (trimmedLine.startsWith(">")) {
       // Save previous record if exists
       if (currentHeader !== null && currentSequence) {
         records.push({
           header: currentHeader,
-          sequence: currentSequence.toUpperCase().replace(/\s/g, ''),
+          sequence: currentSequence.toUpperCase().replace(/\s/g, ""),
         });
       }
       // Start new record
       currentHeader = trimmedLine.substring(1).trim(); // Remove '>' and trim
-      currentSequence = '';
+      currentSequence = "";
     } else if (currentHeader !== null) {
       // Sequence line
       currentSequence += trimmedLine;
@@ -59,7 +59,7 @@ export function parseFastaRecords(content: string): FastaRecord[] {
   if (currentHeader !== null && currentSequence) {
     records.push({
       header: currentHeader,
-      sequence: currentSequence.toUpperCase().replace(/\s/g, ''),
+      sequence: currentSequence.toUpperCase().replace(/\s/g, ""),
     });
   }
 
@@ -71,24 +71,27 @@ export function parseFastaRecords(content: string): FastaRecord[] {
  * @param content - The FASTA content to validate
  * @returns FastaParseResult with validation details
  */
-export function parseFasta(content: string, selectedHeaders?: string[], lenient?: boolean): FastaParseResult {
+export function parseFasta(
+  content: string,
+  selectedHeaders?: string[],
+  lenient?: boolean,
+): FastaParseResult {
   // Check if content is empty
   if (!content.trim()) {
     return {
       isValid: false,
-      error: 'FASTA content is empty',
+      error: "FASTA content is empty",
     };
   }
 
-  const lines = content.trim().split('\n');
-  if (lines.some((line) => line.trim() === '>')) {
-    const error
-      = 'Headers cannot be empty. Please provide a name after ">" (e.g., ">ref_name").';
+  const lines = content.trim().split("\n");
+  if (lines.some((line) => line.trim() === ">")) {
+    const error = 'Headers cannot be empty. Please provide a name after ">" (e.g., ">ref_name").';
     return { isValid: false, error };
   }
-  if (lines[lines.length - 1]?.trim().startsWith('>')) {
-    const error
-      = 'FASTA content ends with a header but no sequence. Each header must be followed by sequence data.';
+  if (lines[lines.length - 1]?.trim().startsWith(">")) {
+    const error =
+      "FASTA content ends with a header but no sequence. Each header must be followed by sequence data.";
     return { isValid: false, error };
   }
 
@@ -104,14 +107,14 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
     return {
       isValid: false,
       error:
-        'No valid FASTA records found. Please ensure the content is in FASTA format or a single raw sequence.',
+        "No valid FASTA records found. Please ensure the content is in FASTA format or a single raw sequence.",
     };
   }
 
   // Check for mix of headered and non-headered sequences
   if (records.length > 1 && records.some((r) => !r.header)) {
-    const error
-      = 'Multiple sequences detected, but some are missing headers. Please provide headers for all sequences.';
+    const error =
+      "Multiple sequences detected, but some are missing headers. Please provide headers for all sequences.";
     return { isValid: false, error };
   }
 
@@ -130,21 +133,19 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
     }
 
     const recordIdentifier = header ? `Record "${header}"` : `Record ${i + 1}`;
-    const headerRoot = header ? header.split('|')[0]?.trim() : '';
+    const headerRoot = header ? header.split("|")[0]?.trim() : "";
 
     // Clean the sequence (remove whitespace, convert to uppercase, and normalize IUPAC wildcards to N)
     const cleanSequence = sequence
       .toUpperCase()
-      .replace(/\s/g, '')
-      .replace(/[RYWSKMBDHV]/g, 'N'); // Replace all IUPAC wildcards with N
+      .replace(/\s/g, "")
+      .replace(/[RYWSKMBDHV]/g, "N"); // Replace all IUPAC wildcards with N
 
     // Validate sequence contains only valid DNA characters (excluding wildcards which we already replaced)
     const validDNACars = /^[ACGTN]+$/;
     if (!cleanSequence || !validDNACars.test(cleanSequence)) {
       const invalidChars = cleanSequence.match(/[^ACGTN]/g);
-      const error = `${recordIdentifier}: Invalid DNA characters: ${invalidChars?.join(
-        ', ',
-      )}`;
+      const error = `${recordIdentifier}: Invalid DNA characters: ${invalidChars?.join(", ")}`;
       return { isValid: false, error };
     }
 
@@ -163,7 +164,7 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
     }
 
     // repseqio fromFasta rejects sequences with wildcards, so replace N→A for V/J genes.
-    const sequenceWithoutN = cleanSequence.replace(/N/g, 'A');
+    const sequenceWithoutN = cleanSequence.replace(/N/g, "A");
     const referenceSequence = cleanSequence;
 
     // Translate DNA to protein for pattern validation using the adjusted reference sequence
@@ -175,8 +176,8 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
     }
 
     // Apply the regex validation and capture CDR3 (up to the conserved W/F/L/Y/I)
-    const validationRegex
-      = /C([ACDEFGHIKLMNPQRSTVWYX]{4,50}[FWYLIX])[ACDEFGHIKLMNPQRSTVWYX]{0,5}G[ACDEFGHIKLMNPQRSTVWYX]G/;
+    const validationRegex =
+      /C([ACDEFGHIKLMNPQRSTVWYX]{4,50}[FWYLIX])[ACDEFGHIKLMNPQRSTVWYX]{0,5}G[ACDEFGHIKLMNPQRSTVWYX]G/;
 
     // Only search from position 80 onwards (240 nucleotides)
     const searchStartPosition = 80; // 240 nucleotides / 3 = 80 amino acids
@@ -189,11 +190,11 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
         return { isValid: false, error };
       }
       // In lenient mode, split at 2/3 of the sequence as a rough V/J boundary estimate
-      const splitPoint = Math.floor(cleanSequence.length * 2 / 3);
+      const splitPoint = Math.floor((cleanSequence.length * 2) / 3);
       const vGeneSequence = sequenceWithoutN.substring(0, splitPoint);
       const jGeneSequence = sequenceWithoutN.substring(splitPoint);
-      const vGeneHeader = headerRoot ? `${headerRoot}_Vgene` : 'ref_Vgene';
-      const jGeneHeader = headerRoot ? `${headerRoot}_Jgene` : 'ref_Jgene';
+      const vGeneHeader = headerRoot ? `${headerRoot}_Vgene` : "ref_Vgene";
+      const jGeneHeader = headerRoot ? `${headerRoot}_Jgene` : "ref_Jgene";
       vGeneParts.push(`>${vGeneHeader}\n${vGeneSequence}`);
       jGeneParts.push(`>${jGeneHeader}\n${jGeneSequence}`);
       if (header) headers.push(header);
@@ -218,14 +219,14 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
     // Use sequenceWithoutN (N→A) since repseqio fromFasta rejects wildcard nucleotides
     const vGeneEndNucleotides = cdr3StartNucleotides + cdr3HalfLengthNucleotides;
     const vGeneSequence = sequenceWithoutN.substring(0, vGeneEndNucleotides);
-    const vGeneHeader = headerRoot ? `${headerRoot}_Vgene` : 'ref_Vgene';
+    const vGeneHeader = headerRoot ? `${headerRoot}_Vgene` : "ref_Vgene";
     const vGene = `>${vGeneHeader}\n${vGeneSequence}`;
 
     // J gene: from second half of CDR3 to sequence end
     // Use sequenceWithoutN (N→A) since repseqio fromFasta rejects wildcard nucleotides
     const jGeneStartNucleotides = cdr3StartNucleotides + cdr3HalfLengthNucleotides;
     const jGeneSequence = sequenceWithoutN.substring(jGeneStartNucleotides);
-    const jGeneHeader = headerRoot ? `${headerRoot}_Jgene` : 'ref_Jgene';
+    const jGeneHeader = headerRoot ? `${headerRoot}_Jgene` : "ref_Jgene";
     const jGene = `>${jGeneHeader}\n${jGeneSequence}`;
 
     vGeneParts.push(vGene);
@@ -234,8 +235,8 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
   }
 
   // Create single FASTA strings for all V and J genes
-  const vGenes = vGeneParts.join('\n');
-  const jGenes = jGeneParts.join('\n');
+  const vGenes = vGeneParts.join("\n");
+  const jGenes = jGeneParts.join("\n");
 
   return {
     isValid: true,
@@ -246,70 +247,70 @@ export function parseFasta(content: string, selectedHeaders?: string[], lenient?
 
 // DNA to protein translation table
 const codonTable: Record<string, string> = {
-  TTT: 'F',
-  TTC: 'F',
-  TTA: 'L',
-  TTG: 'L',
-  TCT: 'S',
-  TCC: 'S',
-  TCA: 'S',
-  TCG: 'S',
-  TAT: 'Y',
-  TAC: 'Y',
-  TAA: '*',
-  TAG: '*',
-  TGT: 'C',
-  TGC: 'C',
-  TGA: '*',
-  TGG: 'W',
-  CTT: 'L',
-  CTC: 'L',
-  CTA: 'L',
-  CTG: 'L',
-  CCT: 'P',
-  CCC: 'P',
-  CCA: 'P',
-  CCG: 'P',
-  CAT: 'H',
-  CAC: 'H',
-  CAA: 'Q',
-  CAG: 'Q',
-  CGT: 'R',
-  CGC: 'R',
-  CGA: 'R',
-  CGG: 'R',
-  ATT: 'I',
-  ATC: 'I',
-  ATA: 'I',
-  ATG: 'M',
-  ACT: 'T',
-  ACC: 'T',
-  ACA: 'T',
-  ACG: 'T',
-  AAT: 'N',
-  AAC: 'N',
-  AAA: 'K',
-  AAG: 'K',
-  AGT: 'S',
-  AGC: 'S',
-  AGA: 'R',
-  AGG: 'R',
-  GTT: 'V',
-  GTC: 'V',
-  GTA: 'V',
-  GTG: 'V',
-  GCT: 'A',
-  GCC: 'A',
-  GCA: 'A',
-  GCG: 'A',
-  GAT: 'D',
-  GAC: 'D',
-  GAA: 'E',
-  GAG: 'E',
-  GGT: 'G',
-  GGC: 'G',
-  GGA: 'G',
-  GGG: 'G',
+  TTT: "F",
+  TTC: "F",
+  TTA: "L",
+  TTG: "L",
+  TCT: "S",
+  TCC: "S",
+  TCA: "S",
+  TCG: "S",
+  TAT: "Y",
+  TAC: "Y",
+  TAA: "*",
+  TAG: "*",
+  TGT: "C",
+  TGC: "C",
+  TGA: "*",
+  TGG: "W",
+  CTT: "L",
+  CTC: "L",
+  CTA: "L",
+  CTG: "L",
+  CCT: "P",
+  CCC: "P",
+  CCA: "P",
+  CCG: "P",
+  CAT: "H",
+  CAC: "H",
+  CAA: "Q",
+  CAG: "Q",
+  CGT: "R",
+  CGC: "R",
+  CGA: "R",
+  CGG: "R",
+  ATT: "I",
+  ATC: "I",
+  ATA: "I",
+  ATG: "M",
+  ACT: "T",
+  ACC: "T",
+  ACA: "T",
+  ACG: "T",
+  AAT: "N",
+  AAC: "N",
+  AAA: "K",
+  AAG: "K",
+  AGT: "S",
+  AGC: "S",
+  AGA: "R",
+  AGG: "R",
+  GTT: "V",
+  GTC: "V",
+  GTA: "V",
+  GTG: "V",
+  GCT: "A",
+  GCC: "A",
+  GCA: "A",
+  GCG: "A",
+  GAT: "D",
+  GAC: "D",
+  GAA: "E",
+  GAG: "E",
+  GGT: "G",
+  GGC: "G",
+  GGA: "G",
+  GGG: "G",
 };
 
 /**
@@ -318,8 +319,8 @@ const codonTable: Record<string, string> = {
  * @returns The translated protein sequence
  */
 function translateDNAToProtein(dnaSequence: string): string {
-  const cleanSequence = dnaSequence.toUpperCase().replace(/\s/g, '');
-  let proteinSequence = '';
+  const cleanSequence = dnaSequence.toUpperCase().replace(/\s/g, "");
+  let proteinSequence = "";
 
   // Translate in reading frame 1 (starting from first nucleotide)
   for (let i = 0; i <= cleanSequence.length - 3; i += 3) {
@@ -327,14 +328,14 @@ function translateDNAToProtein(dnaSequence: string): string {
     const aminoAcid = codonTable[codon];
 
     if (aminoAcid) {
-      if (aminoAcid === '*') {
+      if (aminoAcid === "*") {
         // Stop codon - end translation
         break;
       }
       proteinSequence += aminoAcid;
     } else {
       // Invalid codon - add X for unknown
-      proteinSequence += 'X';
+      proteinSequence += "X";
     }
   }
 
diff --git a/ui/src/utils/parseRepseqioLibrary.ts b/ui/src/utils/parseRepseqioLibrary.ts
index ba22baf..d46c24f 100644
--- a/ui/src/utils/parseRepseqioLibrary.ts
+++ b/ui/src/utils/parseRepseqioLibrary.ts
@@ -2,7 +2,7 @@ import type {
   LibraryEntryDefinition,
   VAnchorPoints,
   JAnchorPoints,
-} from '@platforma-open/milaboratories.mixcr-amplicon-alignment.model';
+} from "@platforma-open/milaboratories.mixcr-amplicon-alignment.model";
 
 interface RepseqioGene {
   baseSequence: string;
@@ -53,11 +53,11 @@ export function parseRepseqioLibrary(jsonContent: string): LibraryEntryDefinitio
     const jGenes = new Map<string, RepseqioGene>();
 
     for (const gene of entry.genes) {
-      if (gene.geneType === 'V' && gene.name.endsWith('_Vgene')) {
-        const prefix = gene.name.slice(0, -'_Vgene'.length);
+      if (gene.geneType === "V" && gene.name.endsWith("_Vgene")) {
+        const prefix = gene.name.slice(0, -"_Vgene".length);
         vGenes.set(prefix, gene);
-      } else if (gene.geneType === 'J' && gene.name.endsWith('_Jgene')) {
-        const prefix = gene.name.slice(0, -'_Jgene'.length);
+      } else if (gene.geneType === "J" && gene.name.endsWith("_Jgene")) {
+        const prefix = gene.name.slice(0, -"_Jgene".length);
         jGenes.set(prefix, gene);
       }
     }
diff --git a/ui/vitest.config.mts b/ui/vitest.config.mts
index 49a0dd8..609455d 100644
--- a/ui/vitest.config.mts
+++ b/ui/vitest.config.mts
@@ -1,7 +1,7 @@
-import { defineConfig } from 'vitest/config';
+import { defineConfig } from "vitest/config";
 
 export default defineConfig({
   test: {
-    watch: false
-  }
+    watch: false,
+  },
 });