Chromosome name style in BED file does not correspond to naming style in BAM file

[Ismaelfermir]

Hi!
I had a problem running the first step of the convading tool --> StartWithBam
I have my BAM and BED file in the same chromosome format but for some reason we send me this error:

Uncaught exception from user code:
Chromosome name style in BED file does not correspond to naming style in BAM file. This is probably caused by using UCSC naming style in one file, and other naming style in the other file. Please fix your BED or BAM file chromosome naming.

Can you say me what is the problem with the files please?

BAM file:

@HD	VN:1.5	GO:none	SO:coordinate
@SQ	SN:chrM	LN:16571
@SQ	SN:chr1	LN:249250621
@SQ	SN:chr2	LN:243199373
@SQ	SN:chr3	LN:198022430
@SQ	SN:chr4	LN:191154276
@SQ	SN:chr5	LN:180915260
@SQ	SN:chr6	LN:171115067
@SQ	SN:chr7	LN:159138663
@SQ	SN:chr8	LN:146364022
@SQ	SN:chr9	LN:141213431
@SQ	SN:chr10	LN:135534747
@SQ	SN:chr11	LN:135006516
@SQ	SN:chr12	LN:133851895
@SQ	SN:chr13	LN:115169878
@SQ	SN:chr14	LN:107349540
@SQ	SN:chr15	LN:102531392
@SQ	SN:chr16	LN:90354753
@SQ	SN:chr17	LN:81195210
@SQ	SN:chr18	LN:78077248
@SQ	SN:chr19	LN:59128983
@SQ	SN:chr20	LN:63025520
@SQ	SN:chr21	LN:48129895
@SQ	SN:chr22	LN:51304566
@SQ	SN:chrX	LN:155270560
@SQ	SN:chrY	LN:59373566
@RG	ID:18NR1873	PL:Illumina	SM:18NR1873
@PG	ID:MarkDuplicates	VN:2.9.0-1-gf5b9f50-SNAPSHOT	
A00285:20:HCVJLDMXX:1:2267:2329:11506	99	chr1	11886	0	101M	=	11952	167	CTTTTCTTTGACCTCTTCTTTCTGT
TCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTT	@A>>AGFCCIDGGGIGDIGDDIGHCDIEDICICCDDDIHGICIGIGDCI
HGGEIDGGDIGGDCICIGGDDIGEGGDHHHGHEEIEJEJIDJEGEHFE>CA>	BD:Z:OOPFJTRQGQSPOPOONONNDONPLNOOPQMNMQOOEPQQQMQOOOOMPQPLQQOPPOPPLNPNMQPP
OEPPQNPOOMPQQPFQSQQRSRSSPQUVQQRPP	MD:Z:101	PG:Z:MarkDuplicates	RG:Z:18NR1873	BI:Z:QQRJLVTSKTUTSTQRQSRQISRURRTT
UURRRTSRJTSTURTSRSRRUTPMTUSTTRTSMPSRRUSUSKUTURTQONRQUSKUVUUVSVVWTSXTQTTSR	NM:i:0	AS:i:101	XS:i:101

BED file:

browser position chr1:11981-12351
track name="Padded" description="Agilent SureSelect DNA - SureSelect Human All Exon V6 r2 - Covered bed file extended by 100bp on either side" color=0,0,128
chrM	2568	2698	-
chr1	11980	12351	ref|DDX11L1,ref|NR_046018,ens|ENST00000518655,ens|ENST00000450305,ens|ENST00000456328,ens|ENST00000515242
chr1	12495	12902	ref|DDX11L1,ref|NR_046018,ens|ENST00000518655,ens|ENST00000450305,ens|ENST00000456328,ens|ENST00000515242
chr1	13063	13758	ref|DDX11L1,ref|NR_046018,ens|ENST00000518655,ens|ENST00000450305,ens|ENST00000456328,ens|ENST00000515242

[freerkvandijk]

Dear Ismael,

I think the issue might be caused by a bug. Could you try to delete the first two lines in the BED file and then re-run the analysis? If this doesn't work, then let me know.

Cheers,
Freerk

[Ismaelfermir]

Dear Freerk,

I had the same problem fixing the BED file. I have been looking BED files in UCSC format and they have this aspect:

browser position chr7:127471196-127495720
browser hide all
track name="ItemRGBDemo" description="Item RGB demonstration" visibility=2 itemRgb="On"
chr7    127471196  127472363  Pos1  0  +  127471196  127472363  255,0,0
chr7    127472363  127473530  Pos2  0  +  127472363  127473530  255,0,0

Maybe it is the BAM format?

Thanks

[freerkvandijk]

Hi Ismael,

Did you delete the first two or first three lines of the BED-file? I noticed I should have said first three, to remove all the normal text. Please let me know if you did, I think I found some small bugs in the code which I could point out to you then.
Cheers,
Freerk

[Ismaelfermir]

Yes, I delete the first three lines of the BED file such as:

chrM	10000	10500	
chr1 11980	12351	DDX11L1
chr1	12495	12902	DDX11L1
chr1	13063	13758	DDX11L1
chr1	14520	15115	WASH7P
chr1	15695	16014	WASH7P
chr1	16643	17198	WASH7P
chr1	17147	18221	WASH7P
chr1	18116	18511	WASH7P
chr1	18863	19269	WASH7P
chr1	24160	24632	WASH7P
chr1	24555	24955	WASH7P
chr1	30213	30642	
chr1	35020	35592	FAM138A
chr1	35465	35879	FAM138A

The separator character is the tab. I had the same error with this format of the BED file. Maybe the problem is the bug that you found.

Thanks Freek,

Ismael

[freerkvandijk]

Hi Ismael,

Can you open the file CoNVaDING.pl and try the following:

• Go to line 2275 in the code, there should be three lines of code looking like this:

if ($bedStyleUCSC ne $bamStyleUCSC) {
die "Chromosome name style in BED file does not correspond to naming style in BAM file. This is probably caused by using UCSC naming style in one file, and other naming style in the other file. Please fix your BED or BAM file chromosome naming.\n";
}

For all three lines put a # character in front of them, it should look like this:
#if ($bedStyleUCSC ne $bamStyleUCSC) {
#die "Chromosome name style in BED file does not correspond to naming style in BAM file. This is probably caused by using UCSC naming style in one file, and other naming style in the other file. Please fix your BED or BAM file chromosome naming.\n";
#}

Does that solve the problem? By eye I can't really find an issue with your BED and BAM files.

[Ismaelfermir]

I think I found the solution. The problem was a stupid thing in the CoNVaDING script.
Thanks for the support!

[freerkvandijk]

Hi Ismael,

Could you please provide us with the bug and the solution you've created? That enables us to fix this in a future release of the software.

[Ismaelfermir]

I though that the error was solve but it seems it continuos so I used other tool to get the bed file with the coverage region values. I will check in the next days if it is okay with this pipeline.

I will typing you if it is all okay.

Thanks so much for the help!

[freerkvandijk]

Let me know if you can get it to work. If not, we might be able to help you out by using some snippets of your BAM and BED file.

Cheers, Freerk

[Ismaelfermir]

Hi Freerk!

I found a solution for the bed and bam format problem. I passed to the next step "StartWithAvgCount" creating my own file with the CHR, START, STOP, GENE and REGION_COV for the samples and the controls from the bam files. I calculate the region coverage with another app and it seems that works from this step.

Thanks for the support! I will write you if I have any other problem.

Ismael

[robertosirica]

Hello I'm experiencing the same problem and I wasn't able to solve it, do you have any suggestion? @Ismaelfermir which tool is the one you used to produce the starting files? Is there a workaround in Convading to allow the computation? I tried the suggested approach to comment the lines in the main script but it gives me an error message later on.