From 7b356d7e6abf1689daa2ce2c24c553d9619714bf Mon Sep 17 00:00:00 2001 From: hwkobe Date: Thu, 4 Nov 2021 12:50:48 -0500 Subject: [PATCH] Update README.md --- README.md | 63 +++++++++++++++++++++++++++++++++++++++++++++++++++++++ 1 file changed, 63 insertions(+) diff --git a/README.md b/README.md index 428331f..5140277 100644 --- a/README.md +++ b/README.md @@ -126,3 +126,66 @@ MOFF aggregate -i MOFFaggregation_test.txt - GMT: aggregated guide-intrinsic mismatch tolerence - MDE.sum: aggregated mismatch-dependent off-target effect - MOFF.sum: aggregated MOFF score for specific sgRNA + +### 3. MOFF allele: Predict the genome-wide off-target effects for given sgRNAs + +MOFF allele requires the users to input local DNA sequences of a wild-type allele and a mutant allele. +The two DNA sequences should be of the same length. There should be at least one hit of 20bp+PAM(NGG) in +the DNA sequence for knockout and the mutation point should be included within the hit. If you +want to design the sgRNA to specifically target the WT allele, just input DNA sequence of WT as mutant +and mutant sequence as wildtype. + + Arguments of the program: + + -m MUTANT, --mutant MUTANT + Local DNA sequence of mutant allele, at least one hit of 20bp (mutation sites included) + followed by PAM (NGG) should be included, if more than one hit is found, MOFF will + design sgRNAs based on all possible PAMs. + + -w WILDTYPE, --wildtype WILDTYPE + Local DNA sequence of wild type allele paired with the mutant allele, which should be + the same length as the mutant allele DNA sequence. + + -p PREFIX, --prefix PREFIX + Prefix of the file to save the outputs, in the format PREFIX + _allele_specific_knockouts, + default: AlleleTest. + + -o OUTPUTDIR, --outputdir OUTPUTDIR + Directory to save output files, if no directory is given, a output folder named + MOFF_Allele will be generated in current working directory. + + +#### Example to run MOFF allele + + For example two mutant for DNMT3a: + ACTGACGTCTCCAACATGAGC|CGC|TTGGCGAGGCAGAGACTGCT (WT) + ACTGACGTCTCCAACATGAGC|tGC|TTGGCGAGGCAGAGACTGCT (R882C) + ACTGACGTCTCCAACATGAGC|CaC|TTGGCGAGGCAGAGACTGCT (R882H) + + 1). To knockout R882C allele + MOFF allele -m ACTGACGTCTCCAACATGAGCTGCTTGGCGAGGCAGAGACTGCT -w ACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCT -p R882C + + 2). To knockout R882H allele + MOFF allele -m ACTGACGTCTCCAACATGAGCCACTTGGCGAGGCAGAGACTGCT -w ACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCT -p R882H + + 3). To knockout WT in R882C cell + MOFF allele -m ACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCT -w ACTGACGTCTCCAACATGAGCTGCTTGGCGAGGCAGAGACTGCT -p WTinR882C + + 4). To knockout WT in R882H cell + MOFF allele -m ACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCT -w ACTGACGTCTCCAACATGAGCCACTTGGCGAGGCAGAGACTGCT -p WTinR882H + + +#### Columns of Output table + + - sgRNA: all the possible sgRNAs selected for allele-specific knockouts + - DNA_KO: DNA target of allele you want to knockout, usually it is the mutant allele + - DNA_NA: DNA target of allele you want to keep, usually it is the wild-type allele + - GMT: Guide-intrinsic mismatch tolerence for the designed sgRNA + - MOFF_KO: the predicted MOFF score to target the DNA-KO + - MOFF_NA: the predicted MOFF score to target the DNA-NA + - MOFF_ratio: the ratio between MOFF_NA/MOFF_KO + +**To knockout desired allele, please select sgRNA with a high MOFF_KO score to knockout (MOFF_KO > 0.5 is suggested)** + +**To maintain specificity of sgRNA, please select sgRNA with low MOFF_NA relative to MOFF_KO (MOFF_ratio < 0.2 is suggested)** +